Description :
From Genome Similarity Track
Location :
scaffold_132:33699- 40827
Sequence
7128 bases(100 bases per row)
GTATCAACATGGGCAACGCGTTCCTACTGGCGGCTGTGAAGGACCGGCAAGCTGCGGTGCTGGCTGACGCTATCTTTCCCTTCGACAACTTGCAGCTACA
CGAGATCGAGACGTTCTGGCGCGCGTTCTACGACTCGGCGACGAGCTTTGCGCTGTCCAAGGGCCAATTTCGATCTATTTGCTGCCGTGCAGTCGCCTTG
GGTGTTTCTAGTCTGCAAAGCTCTCATTCTAGAGTTGCAGAGTATGCTGATGCTGCCTTTGAGCTGTTTGCTGATCCGCTGATGCAGAAACGATGGCAGC
AAACGCAGCTAGGGTCTCGAGGACTGCAGAGTCAACAGTACCAGAGTCCGAGCGACAACTTGGCGGTGATCGACGCGCTCGAGTTCCTATCAGCTATTGC
ATTCATTGCTGCTATACCGTTGGACGAAAAGGTTGATTTGCTATTTGACTCATGGGATATGTCCGAGGACGGAGCCTTGGATTTGGACGAGTTCACGATA
TCCTTGAAGTCGACGCTGTCAGGACTAGCAAAGATTCTTCAACCGAATTCGAACAGCAAGGCGGTGAACCTGGACACAACGGTCGATGAAGAGGAAATTA
TTATGCTTGCTGAGTCGATGTTTCGGGAGATAACTAACTGCGGCGTTTCATTGTCAAAGGATAAAGGATCCGAAGCGGACCCAGCTACAATCACATGCGA
GCAATTTCGGGAGTTCAGCTTGAAGAACAAGCGAGCAAAAGAGCTCTTTGAATTGTTCGATGTGGCAGGCTCCAGCTCTGGACAACACGAGCTTCATTCT
GTCGAGGAAGGGACATCCGTGGAGAATGCGGAAAGTATTGATCTGGTGGCTAAACTTGAAAAGCACACGGATCCCCCAGACTCTTCGACAGTAGTGATGG
ACGTTGCACAGGATGACGTTGGTGACATGTTTCTAGCTGTGAAGCCATGGATTGGAGCGATTGTGCCTCCAAGCAAAATCCCTGCGCTATCCAAAGGAGC
TCCATTGGTTTCAGTCAAGCTGGACTGGATATTTGGCTACAGCGCACAAGATTGCAAGAACAATGTACGCTTCGTAACAACTGCAACCAATGCTAAGGCT
GGGCGCATCGAAGAGATCGTATATCCAGCTGCTGCAGCTTGTGTTGTTTTAAACACAAAGGCAATGGAGCAGCGCCACCAACTCACCCACACAGACGATG
TTCTGAGCTTGTGCCTGCACCCACGTCTCTCCCTAGCTGCAAGCGGTGAAATTGGCAAGCAGCCCAAAATTGTTGTGTGGGATATGGACTCAATGGAGGT
GCAGTGTATCCTGCAAGGGTTTCACAAGCGCGGAATCTTACAATTAGCTTTCCTGAGCCCTGAGCTGCTGGTATCGATTGGAGGAGATGACGATCACAGT
ATTGCAATTTACGAGTCGAGCAATAACTGGAAATCTGCAGTACTGAAAATCTCAGTAAAAGGCAACAAAGCAGTCCCATTTCACATCACAACGAATCCTC
GCGTCCCAAACGAGTTTGTCACGTGCGGTCAAAAGTACATTGAGTTTTGGTCCCTCGAGGGGAAGGAGCTCGTGCCGAAGAAGGGTTTGCTGGGAAAGAA
GGGATCGCTCCAGCCATTTCCCGTGGCCCAATACCTCGAATCAGCAGACCAGGCCGTCGTTGTGGGAACCAGCGATGGTTCCTTGTATCTTTTTGTCGGT
AGGCAGCTGACAAACGTCGTGAAGGCGCATGAAGGAGCCATCACTGCTTTATCTTACTCTGCAGGTTTGTTGCTGTCGGGAGGCCGGGATGGCCAAATCA
TTCAGTGGGATGATAAGTTGAAACAAGTTGGCACTCCAATCCAGATCCAGGATTCCCTTGAATCCTCCTCACTTTCTCAGCGCAAGGGCATACGAAGCTG
CTGCTATTCTCCAGATAGACGAACCATTCTCGTTGGCACACTCGCATCGGAGATTTATGAACTGGATGCGAAGTCAGGACAGAATATTCACTCGGAGCCT
CTTACTAAAGGGCATTTTCAAGGAGAATTGTGGGGGTTAGATGTTCACCCCTCTAAGCAACAGTGTTGTACGGTCGGAGATGATCAGACCCTCCGCATCT
GGGATTTATTAGCGCACCATGAGATGGGATTCCTAAAGCTACCAATACCAGGACGTGCTTGCGCATACTCGGGTGATGGCAAATTAATCGCGGTTGGGCT
TGGCACTGAGGACTCTGGAAAAGCAAATGCAGCAGTCAACGCGAAGAAACGACAGCCCAATGGAGGTTTCGTGGTGTACAGTGCTAATGATTTGACCTGT
GTGAAAGAACCCTGTTTTGACGCGAAGAGGTGGGTTAGCGATGTGAAGTTCTCACCCGATAACCGAACGTTGGCTGTAGCGAGCCACGACTCCAAAATCT
ACCTGTACAACGTTTTGAAGGGGTTTTCACGGACTCATGTATTCAACAAGCACTCAAGTTATATCACTCATATGGACTTCTCACTGGATGGGAACTATTT
GCAGAGCACGTCGGGAGGATACGAGCTGCTTTTTACCGAGGTCAAGACAGGAAAACACATCACAAATGCGTCGACCTTTCGAGACGAGTTATGGCATACA
ATGACCAGCACGTTGGGGTGGTCGGTGCAAGGAATCTGGGAAGCAGAGAGCGATGGAACTGATGTTAACGCTGTAGATCGCTCCAACAACGGGAAATTAC
TGGCATCTGGTGACGATTTTGGAAAGATGAAGATTTTCCAGTACCCTTGTGCCTTGGAAAAGGCTTCTTTTCTTGAGTTGCGAGGTCATGCTTCTCATGT
CACGAAGGTCAGGTGGTCATTTGACGACAGCTACATTGTTTCTGTTGGTGGTAATGATAGATGTGTCTTTGTTTGGGGACACGACAAACAACCCTCCAAG
AAGGATAATTTCAAGCGACGTATTAGTGAGACGAGCAGTGAAAGTGACGACATCGACTTACTGGACAAAAGAGCTGAAGATCCATTGGAGGTCGTGGCTA
TGAATGATGATATCGGGGATGAGTTTATGGCTGTACGACCGTGGCTTGGGGCTGTCGTGGCCCCTTCGAAAGCTGTTTCAATGAAGGTGGACAGCAGATC
TCCAAGCACGAGGCTCGAGTTGGAGCGAGTGCACGGATATCAGGCTCAAACAGCCTCAAACAACGCCAGATATGATTCGAATGGCAAGGTGGTGTATCAT
ACCGCCGCACTGGGCATTGTTTACGACAAAGCTACTCAACGTCAAGCGTTTTTCAAGAGTCACGACGACGATGTTGTGGCGATGTGTGCTCACCCGGACG
GAAAAACGTTTGCAACTTCTCAAATGGGAAAGAAACCCAAGATTTACGTCTGGGACTCGGCAAGCGGAGAAGCGGTTGCACCTTGCCTTGAAGGATTTCA
CCAGCGCTTTGTCAATGCAATTTGCTTTTCGAGTGATGGTACGAAATTGGGCAGTGTTGGTGGCGATGATGATCATTCCATTGCGATTTACAATTGGAAA
AGTGCGGTAATGGTGGCTCAATCTCGCGGAGAGCGAAACAATGTGCGTGGTATCTGCTACCACGCTGCTACTAAGGAATGGGTGACGTGTGGTGACAAAC
ATATTCGTTTCTGGACGGAGCAAGGAACGAATCTCTCTTCAAAGAAGGCGATTTTCGGGACTAAGGCGTATCAAAACGGGAAGGTGCCGTCATTTTTTGA
CTGTGTTGTGTCATTTGGGCAAATGATTATTGCTGGGGCCTCGACTGGTCACCTTGTGGTATTTCAAAGCTCTGTGGAAGTAACTAAAGCTATCCAAGCT
CATGACAATGCTGTATTAGCTCTCTACGCTTCAGAACGTGAATTGATTAGTGGCGGAAAGGACTCTAAGATAGTCGTGTGGGACTCGCAATTCAACAAAG
TGGCAACTTTTGATATGAAGGAGCACACACTCCAAGGAGCCAAACTTTTGAATTCTGAGATTCGAAGTGTTTGCTCCAGTCGAGTTTCTCCCCGAGTTTT
CTTAGTTGGAACGGGAGGTAGTGATCTTTTCGAATTCGATGCTGGTCGGGCCCAGCCAACCCTATCAACAATCACTTGTGGACATTGTAAGATGGAGGTC
TGGGGGCTTGCTTGCCACCCTACGAAAGCTGAGTACTGTACCGTGGGTGACGACCAGACTATTCGCGTGTGGTGTTTATTAAAAAAGAACCAATTGCGAG
TCCAGAGACTTGAATGTGTTGCTCGAGCATGTGCACTGACAGATTCGGCTGACATCGTCGCAATCGGATTTGGTGGGCGTAATGCAGTCACCGGGCTTTC
GAAGGCAGCCCAAGCTAAAACAGGGGGAATTGTGATACTCTGCTATACGAATTTGACGCAAAAGCTGTTTGAAGACCGACCATCGAAGCAAGCTATCAGT
GAAATGAAGTTTTCGCCAAATGGCTCCGTTCTGGCCGTTGGATCGCATGACCACAAAATTTATCTCTATCGCCTGGAGCGCAATGCAATGAAAGTCGTGA
AGGCAGCAGTCTTCGACAAACACCAGAGCTATATCACTCACTTGGATTTCTCGGCAGATGGTCAAGTCTTACAGAGCAACTGCGGTGCCTACGAACTTCT
GTTTAGTAATGCCACCACCGGGAAACATATCACGTCTGCCAGCAGCACGAAAGACACTCTGTGGCATTCATGGACGTGCGTGCTAGGGTGGCCTGTGCAA
GGCATTTGGCCACCGTGTTCCGACGGCACCGACGTCAATGCTGTCGCCCGCAACTCACGCGATAATCTTTTGGTCACTTCAGATGATTTTGGTCTGGTCA
AGCTTTATCGATATCCTTGTCTGGCAAAGAATGCGAGCTCGGTAGACCACCGCGGGCATTCATCTCACGTTACTAATGTCCGGTGGTCTCATGATGACAG
CTACGTTGTAAGTGTTGGTGGAAATGACAGATCTGTCATGGAGTGGAGAGTGTTGGGCGAGAACGGAGGAATCCCATCAGGAACAGGGCCCGAAAAACAA
TTAATTCGAACGGAACCAGAAGACACAACGGATTCGTCGGTAGAATCAGAGGAGGAATCCTTCGATGACGCGGTGGGGGACGAGTTTATGGCTGTGAAGC
CTTGGATAGGAGCAATCGTTGCTCCCACGAATGCTGCGACTCCAAATTCACGTGAACCAGACTTGGGTGTTGAGCTGGAATGGGTTTACGGCTACCAAGC
AGAAGTGTCCCAACAGAATTTGGTGTACAACGCCCAAGACGAGGTCGTTTACCACACGGCTGCGGTGGGGATCGTTTACGATTCCATGAACCATCTGCAA
CGACACCACATCGGGCACAATGATGATATTATCAGTTTTGCCATTTGTGATCTTAAACGAAACCTCATTGCAACAGGAGAGCGCGGGAAGAAGCCAGCTT
TAAGAGTTTGGGATGCCCATACAGGTGAGTTATGCAGTGAAATGAAGGAGTTCCATACGCGTGGAATTTTGTCGGTTGCCTTCAGTAATGACTCGACAAG
ACTTGTTAGTGTGGGGGACGATGATGATCACTCGCTGGCTGTTTGGAATGATGCCAGCAATGGATCGTGGAAGCTGGTGAAGCTCCTGGCTACTGGTAAA
GGTGATAAAGCTGTGAATCGCTTCGCGTGTTTCGGGACAAACGCTGATTCCGTTATCACTGGTGGCGTCAAGCACGTGTTGTTTTGGTCTATCCAAGGTA
AAACTATCGTCTCGAAGAAAGGGGTGGTTGGGAAGAAAGGTAGTTTGCAGACTTTTCCGACAGGTTGTAACTTTGGAGGAGATTTTATCACGGGCACTGC
AGGTGGCGAGCTGTATGTATGGAGAGGCAATGATCTTATGAGAACAGTGAAGGCTCATGATGGAGAGGTTCGTGTTGTTGCCAGTACCAGCTCAACTGAA
AATCCTGCCGGGAATTCCCCCGTACTGTTATCAGGCGGTAAAGATGGCCGTGTTGTGATGTGGAACTCGTCGTACCAATCGCTCAAGTGTTTTGACCTGG
ACGCGATGCACGTGGGGAGCTTCGGTAAAGGCATCAACAGTGTTTTTTTAAACTCGACAGGCAGAAAACTGCTTGTTGGCACCTCCTCTAGCGACATTAT
CGAGATCGATGTGGCGAGTGGAGGTGTTCTTAACGGCGGGCAGCCGCTATTCTCTGGCCACTTCACGATGGAGCTGTGGGGTCTAGCGGTGCATCCTTCG
CAGCGACAGTTTGTCACGGTTGGCGACGACCGAACATTGCGTGTGTGGGATATGGAGTCAAAGCGATTGATTCAGGCGCGTTTACTCCCTGCAAAAGCCC
GAGCTTGCGCGTACTCGCCTGATTCGGAGCTACTTGCGGTAGGCTTTGGCGGCGACAATGGAGTTCGACAAAGGAAGAAGGCGGCGTCGAAACCAGGACA
AACCCAATCAAGAGAAGGAGGCTTTGCTATCTTGCAGACGCGCGAGCTGGACACTGAGAAACTGGTGTTTGAGGACAAACCAGCAAAGGAATGGATCAGT
GACGTGAAGTTCTCGCCCAACGGAGAAGTTTTAGCACTCGGTTCCCATGACAATTCGATCTATCTGTATTCGGTGAGTGCCGGAGCGCAAGAGTTCAAAA
AGCGCAAGCCATTCAGCAAACACAACAGCTACATCACGCACTTTGACTTTTCAGACGACAGCAACTACATTCAGTCGAACTGTGGCGCCTACGAGTACTT
GTTTTGTGATACAACATCCAGCAGTCAAGTTAGCAGGGCATCATCTGTGCGCGATGTGAAATGGGCGACCTGGACATGCACGTTAGGGTGGCCTGTGCAG
GGAATTTGGCCCGAATGTGCTGATGGAACCGACGTAAATGCGGTGTGCGCGTCTTCATCACGCACAATCCTCGCATCCGGCGACGACTCCGGCAACGTCA
AGTTCTTCCGCTACCCATGCATTCCGAAAGGGGTACGTCCAACGATGATTTCACGTGTCCTGCACGCATCTAACATTGTTTTTTGTTTGTTTCAAAGTCG
ACATTTATCGCGTGCAAAGGTCACTCCTCCCACGTCGCTAACGTGCGCTTCAGCTTCGACGATAAGTATCTCATCTCAGTGGGAGGAAACGACAGGTCGA
TTTTCCAGTGGAAGCTAGCGTAGACTGC