Description :
From Genome Similarity Track
Location :
Scaffold_93:33697- 37812
Transcript NameFunction/comments
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_93-abinit-gene-0.82Phosphomevalonate kinase protein

Sequence
4115 bases(100 bases per row)
CCGTGTGCGTGTCGGCGCCAGGAAAAGTGCTGATCACCGGCGGGTACCTCGTGCTCGATGCGCAGTACTCCGGGCTCGTAGTAGCCAGCACCGCGCGGTT
CTACACGCGCGTTTGCTCTGCGAAGGTCAGCGAATCTCCTGTCGTGCGCAGCATGTAACAATCACATGAGCCAAGGGCACTCACCAACACTCGCATTGCA
TGCAGGCGGAAGCAGCAACCAGCGCTAATAGAAGCGACGACATCGATGTGCGTGTCGAGAGTCCGCAATTCGGGCAGGCCATCTGCGGCAAACTTTATCG
CAATGATAAGTCGGGGACGTACCAGTTCGTTGTGAGGTATGAGTGTTGCAACAAAGACGCTGAGCGCTCGCTTGTCATGCTCACAAACAATTACTTACTT
TGCAGCGAAACGTCGGACCGCAATGCGTATATTGAAGAGACGCTCGTATGCGCGATGAACGGCATTGCCGGCCTTGCGCCGCATAGTGTTGCGGGCAAAG
TTGAGGCACTGCACGAGGCAGCGTCCAGAGTCCACGTCGTGCTGCAAGCGGACAACGACTTTTACTCTCAAGTCAAACGAGTACGATTCTGGCTTGCTTG
CTTGCATGTGCTTGTGATAGTAATCCTCACTCTATCGTTCATGTGCTTTTTAATTTGGCGTATGTAGCTTCAAGCCGCGAACCAGACCCTTCATCGACGA
AACCTTGCGTCGTTGCCAAAGTTTCTGCCTCCATATATGCAAGGTACGTGCCCATTCTGAAGTTGAAAGCTATCCACACTTGATAACCTCCTTCATGTGG
AGCTAATTGCATGCAACCACGGCTTTAGAGCAACCAAACGGTGACAAAGTGGCGATGAAAACGGGCCTCGGCAGTTCTGCAGCGCTCGTGACGTCTCTTG
TCGGCGCTCTCGTGCATTATTTCCTTCCCGCTGGCACCACCCAGTCGGACTCACTCAAAGACAACGACCAGCGACTCGAGCTCATTCACAACCTGGCGCA
ATTGAGCCACTGCTTTGTGCAACGAAAGGTAAGTGGCCTTGCTATTCTTTGTAGCAAATTGCGTCAGACTAATCAGGTGCTGGTTTGCTTCTTGCTTGCG
CTCAGATTGGAAGTGGCTTTGATGTCTCGGCCGCGTGTTTTGGCTCCCAGTGCTATACGCGCTTCCCAGCGTCCATTTTAGATGCCTTCACGTCGCCCGA
GGCGCTGCGACCGGAGGAGATCACGCAATGCATCACAGACCGTGCAAAGTGGGACATTGCGAATCGTGTGGTGGGTGTTCACTGCAGCCTAACTGGCTTT
GCTTTATCATAATCACATTGACGCATAATTCTTCTGCGCATATTATGCATAGAAACCGTTCAAGCTGCCATCGGGCTTCCGTTTGATCATGGGCGATGTC
ACCGCTGGCTCGCACACGGTGTCCATGGTCCGAAAGGTACCAGAACCGCTGCTTCCGCTTGTTCGTTGAGGAGACAATAGAAATGGTTTCCTATCTGATC
CTCAGTGTTTGCGTGATAACATCTATAGGTCCTGACGTGGCAGAAATTGCAGCTGGAGCAAGCCACTCGCGTCATCACATTGCTGAACGGCTACAATTCT
CTAGTGGAACAAGGCTTCACGAAGCTCCACACCTTGCTTGCTGAATGTGACCCACAAACTGAAAGAGAGTGTTTGCAAATGGCGAACTCCACGTTTGAGC
AGGTAGGCTTTAGCTGAGTTGCAATCGAAACTTGCGCCTTTACGTGCTCTAATCGCTGTTTTCGTAGTGGGAGGTACTGAACCCGGTTCTTGGAAGCGTG
CTGACTTCGATCCGCGAGTCGTTCCTGATGGTGCGACACTGCTTGCGGTGCGTGGCTCACGTGCAATGCGCTTGTAAGGATGTCGTAGAGATCAAGGCGT
GATTTTGATAAATTATCGGCGCGTGGCCAACTTGTAGGGAAATGGGCGAATTGGCGCAGGTCCCCATTGAGCCCCCGGAGCAGACCGAGTTGGTTGACGC
GACCATGGCGATCCCGGGCGTGCTCATCGCGGGCGTCCCTGGAGGTTTGGATCGGCACAAAGCTATAAACTTCTTTCATTTATATGAGACTAACTATGGC
TTTGTGTTGTAGCTGGTGGGTATGATGCCGTGTTCGTGGTCGCGTTGGACGAGTGTGTTCTCGAGCGCATTGAGGAGCTCTGGGCCACGTGGCCGCAGAT
GCACCCGACCTCACTGTGCGTACACTGGTGCATGCCTATAGACCAGTACTTGCAATGCTGCATTGATCGAGCGCCAACTTTTCTCTGTGTGATGTGCATA
TTGATTGATATGTAGCATTTGCCCCTTGCTCTGTGGCGATGTGAATGAAGCACCACTTCAGACAGGGTTACGTATCCATCCGACGGGTACCGTAACCTCC
GAATAACCCACCGAGTATCCACTAGAACTAAATCCTCGATGGAACATGCTAACTCCCCATGAATAATCGAAGTATCGATGAGTAATTACGACGGAATTGT
ATCCACGCTCTATTTTGTTTCGAATTTCTCTTCTTTTTTTTTCATCATTTCACTATTTGCACCATGACGACGCTTAACCTCAAGCGCAAACAGCGCGACG
AAGATGCACACGACGGCGTGCAGACGAGCGCCCTCAAGCGCAGTGCGCCACACAAGAGCGCAGTCAATGTCTTAGACGACCCACAGGCGGAAAGTGTGGC
TCCAAATGACCACGAGCACGCTCAGCATAAGCAAGAAGGAGCGGACGAGTTGAAGACCAGCTTGGTTCCACTATACAAGACGACCACAGAGACGGCCTCG
GCAGACTTCTCTATCGACAAGTTGCGGTTTGGCTCGGAGTCATGGCAGGGCATGAAGCCCACGAACGAGGATCGGGCCTTTGCGGACGCGACGGCGCGGT
TCCNNNNNNNNNNNNNNNNNNNNNNCCCGTGTTTGGCGTGCTGGACGGCCACGGCGGCGTGTTCACGGCCGATTTCCTCGTGCGCAATCTGGTGAAGACC
ATGAGCTCCTCGCTAAAACAAAATATCCGCGGAAGCGACCACGACGCACTGAGTGACATGCGCGAGGTGGCGCACGCAGAGTTGGCGCGAAGACGCGAGA
TCGAGACGCAGTTGAAGTTGTTCCAGGAGCAACTGGGTCAAGTGCAGCAGCTGATGACAACCGAGACTGATAGCAGCAGTGGTAGTAACAAAGATAGCGA
CAGCAGCGGCGACAAGGATGTGCATGCGCTGAACGAGCAGCTACAGAGTGCTGTGCGCGCTATGGAAGCTGGGATCACGCAGATCGACGCAGACGACGCG
CAGCGCAAGCACGAGTTCCAGACGTGGTGTCACGCGCAAGACGCCAACTTCAAGCGCGCGTTCACGGAGGCGTTCCAGCGATGCGACGCGCAAGTGCTGC
TCAAGAACCCGTCGCGAGATGGCTCCACGGCGCTGTTGGTCTGGTTCGTCGCAGGTGGGCCGCTGTCGTCGGAAATAGCGTACTACACGATCAATCTGGG
CGACTGCCGCGCAGTGCTCTGTCGGGGCAGCCATGGGATCCCACTGTCCACAGACCACAAACCCGATCGACCAGATGAGAAGCAGCGCATCCAACGGAAG
GGCGGCTTTGTCGGCACGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGTGGAACAG
GACGATTTGTTTATCGTGCTCGCGTGCGACGGTATCTGGGACGTGATGAGNNNNNNNNNNGACGCCGTGGTCATCGGCTTGCAGCACTTTGAGGATCCAC
AAAGGGCAGCCGACGCTATCGTGAAGGAGGCGTACCGGAGAGGGAGCAGCGACAACCTCACAGCGACGGTAATCCAGTTTGGGTGGCAGCACGATGCTGC
GGCAAAAGCCAAGCAAGCACTGNNNNNNNNNNNNNNNNNNNNNNNGCGCATGCAAAGACGTCGGCAGAAGTAGGCTCCAAAGCGTCAGTGCTGGGAGGAA
ATCCGCGGCTCGCAG