Description :
From Genome Similarity Track
Location :
contig_114:3369- 8425
Transcript NameFunction/comments
g11350.t1hypothetical protein PHYSODRAFT_247933
g11351.t1hypothetical protein

Sequence
5056 bases(100 bases per row)
ACTTGCACCCGGTTGCAGAGCGTAAGAATGTGATTTACATGGGTACGCTGGTGCGAGCTGGCCGTGGGAGAGCTGTGGTGGTCGGTACAGGCTCCCGCAC
CGAATTCGGACAAGTCTTTGATGTTGTGCACAAGGTGGAGGAACGCAAGACGCCGCTGCAGAACAGCATGGACACGTTGGGCAAGCATCTCAGCATGTTC
TCGCTTAGTGTGATCGCAGTGATCGTGGTCATTGGAGTGATCCAACACAAGGCATGCTCACCATGCTGCAAATTGGCGTCTCGCTGGCTGTGGCGGCCAT
CCCTGAGGGCCTACCAATATGTGTGACTGTTACGCTCGCATTCGGTGTGATGAAGATGGCCAAGCGCCATGCCATCGTGAAAAAGCTGCCTGCCGTCGAG
GCGCTGGGATGCATCAACGTGGTCTGTGTGGACAAGACTGGCACGATCACGACGAACAAGATGGAGGTGATCGAGATTTTCGTTCCGTTTGAAACTGTGA
CCGCTGAGGTGAACGGTATTGGCGAGCGAGTGCGTTCTCCATCACAGACGCTAGATATGCCCAAGAAGAGCGCGCGTTCGGCTGTGACTATGCGTGGTGA
ACCCGTTACCGAGGAATCCCACCCCCATGTTTATCACTGCCTCCTATCCGGTGCGCTGTGCAACAACGCGACTATCGTGGACCGAGAAGTTTTGGGCCAA
GCTACGGAGGGTGCTGTTTTGTTGTGTGCGCAGAAGGTGGGGATTACCCCATCGGTCATTCAGCAATTCCGCCGTGTTAGCGAAGTTCCCTTTAGCTCGG
AAAAGAAATGGATGGCAGTGTGCTGTGAGCCACCGATGGGGGCCCTTCTCGCTGGTACCTGAAGGGTATGACGGAAGCTATCTTGTCACGCTGCGATAAG
ATTGAGGATAATTGCGGCCGCGAAAAGGAAATGACCCCAGGAGACCGTGAACGCATTTTTGTGGCGTCCCAGCAAATGGCGGCACGTGGACTTCGTGTGT
TGGCATTATCGTTCGGTGAGCACTCAGATCGTGGTATGGTCTTCGCTGGACTTGTGGGAATCTCAGATCCGCCTCGTGCTGAAGTTGAGAAGTCTGTGTT
GGAGCTTTCTCTGAGCGGGGTCAAGACTGTTATGCTCACGGGGGACTCCAAAGAGACGGCCATTGCAATTGCCACCAAGGTGGGCATCATTTCAAACGAC
CATTTCGGCAGCGTAGAGTGCGACGACGAGAGAATCAAGGCCGTGGACGAACTAGTAATTTCTGGCCAGGAGCTTGAGATCATGGAGATGATGGAGTTGG
AGCAACGCATTCTGAAGACATGTGTGTTTTACCGTACGTCCCCGCGCCACAAACTGAAGATCGTGCGGGCTTTCCAAGAGGCAGGACTGATGGTAGCCAT
GACTGGTGACGGTGTGAACGATGCACCCGCTCTGAAGGCGGCAGATATTGGCATTGCAATGGGCACAAGTGGCACGGATGTTTCGAAGGAAGCGGCTGAT
ATGATTCTGCTGGATGACAACTTCAGCACGATCCTGTGCGCCATGGAAGAGGGCAAGTCAATCTACCACAACATTAAGCACTTTTTGCGGTTCCAGCTCA
GCACAAGCATCTCAGCCCTGTGCCTCATCGCATTCTCCACGTTGTTCAACCTGCCGTCTCCGCTGAACGCCATGCAAATTCTGTGGATCAACATCATCAT
GGATGGACCTCCAGCCCAGAGTCTTGGCGTTGAACCTGTAGACCACGACGTGATGAAGGAGGGCCCGCGCTCCAAAGATGCCAGTATCATCACGCGTACG
ATGATTCGACGCGTACTTACGTCGGCTTGCTTTATCGTCTCAGGCACCCTGTACGTGTTCTGGGTAGAGCTGAGTGATGACGGCATCATTAGCAAGCGCG
ACCGCACCTTGAGTTTTACGACGTTTGTCATGTTCGACATGTTCAATGCGCTCTCGTGTCGATCAGACGACAAGTCCATTTTCGAGATCGGCATCTTGTC
CAACACAGTTTTCGTGTACGCCGTAGGCGCCTCGCTGCTGGGTCAGTTGCTCGTGATTTACTTCCCGCCACTGCAGGCCACTTTCCAGACCGAGGCACTG
ACGCTTGGTGACTTGGTGTACGTCTGCTGTATTGCTTCGAGCGTGCTTATCTTCGATGAGATCCGCAAGTGGTGGCAGGTGCGCAAGCTGCGTGGAGCAA
TGCGCTCTGCGTCCATCGCCGCTGGCTTCAAGCAAAAGAAGAGGAAACACTCGTGGGACAACGACACCGTGTAGATCAGAGAAACAGCGGAGCCCGTGTA
TTATGTTGACGCTTCATACCTGCCGCACACACGAACACGTGGGGGCGAGCTGAATAGACAGATATGCCCGCATAACGCGTTTGGCCTCTCACTGCTTGTC
AAAATAACTTATCGTTGTTCTATCGCAGCCTAGTCTGATGACACCCAAAGCTGCTGCATGGCCGCTTTTACGGCCTGAAACATGTCAACCCCCATAAGCG
CGAGCGCACACGGGACGTTGGGGGAATATTGCTTTACTGCAGTCCGCGTAGTAGCCACGAGCCGCAGCAAGGTCCTGTGGAACACCGTCGCCGATCAGCA
GCATCAAACCGCAGTTGTAGCCAGCCTGAGCGTCGCCTAGTTCCGCTGCAAGCTGGTAACGCTCAAGTGCACGCGTATGGTTGCTCTGGCAGACACCAGC
CCAAGGCTCATGGAAGCATGCACCAGTCTTTCTAACAGCTTCGGAGTCGTTCAGCGCCGCTGCCGACGAATACAAAGCGAACGCTTCATGCAGAGGAGGA
TTAGTTGAGTCCTCGGCAGAATCCCCAAGTCCCAGCCAGCGCCACTTGAGAATGTTGTCACCGTGGTGCTCCAGCAAGAATGCTGCATTGCATTGTGCAT
CTTCGTCGCCCAGCTCCGCAACCAGCCGGTAGTGTAGATACGCTCGCAGGAAGTCGCCCTTCTTGTAGCACTCGTACGCTTTGATCAGAGAGAATGGAAG
TGCAGAGAGGAGGTCCGGATGCAGGGCAACCGTGCGGAACAGCGGCAAAGCGGTGGAGCAAGACGGTGGGGTACCGACACCTTGGAAATGCATAACACCC
AGATTGAATACCGCTTGGCTCGACTGACCATTCGTGCCATCTACAGCCGCCTGAAAGTGAGAAAAACCATATCATAGTCAACCGGAACACCGCCGTCCCC
ATGCAGATACGCTGAGCCTAAGAAAGAGTGTGACTCTGCATAGCCCCGCGTGATGGCTTTCTCAAAGTACTCGAGAGCAAGTGTCACATTTTGACGAACG
CCAGAGCCAGTAAAATACAGCACACCAAGACCGTGAAATGCGAAGGCCTCGTTCTGACGAACGGCGCGGTTGAAATACACGAGCGCTTGTGGGACGTCTT
GCTCTACACCCATGCCGTTTGCCAGGAGCATGCCGTAGTTGGCCTGTGCCAATGGGTCGCCGGCATCTGCTGCTTGGCGGAAGTACTGCGCGGCAAGCCC
ATGGTCAGCTGCCACATGGACTGCCGGGTCTCCGAAGAAGTGGATTTCTCCGAGACGCTGCATAGCCTGTGGGTACTGCTCATCCATGGGGTTGTTTGCG
ATGGCGCGGTAGTACTCCAACTCGTGGAGCGCTTCGTTCTCGTCGCGAAGTGGGTCAGCTCCACCAAAACCGTAATCGTCAAAGAAGCCGCCCCCATTGG
GGTCCAACAGCTCATCCGAAAGACGCACCACTTCCACAGGACGCTCACCACCTTCATCAACGATGGCATGAACGTTTTCCTCTGCACACGTGTGGAATAG
CGGCAATGCCGCTTCGCAAACGCGTCGGAACCTGGTGCACCACTCAGAATTTCATACTTTAAAGGCACTGGAATCCTTCCAGACAGAGTTCCGTACCCCA
CCGCTAAAGTTGCCATGAAGTCATGCGCATCAGCCAAGCTCAAGAGCACTCGGTCTGCACGGGATCGCTTCTCTAGCCGCGACAGGGGAGTTATGCTCGG
GTCCTCCAACTCTTCCGGAGCCGGAACCCCCACTAGATCCAGCATTGCCAGCACGCCCAGTGCGGATTGCACACCTGCATCTGCCGCAGCGTTGAGGTTA
TGAATCGCATCAATAAATGACTGTTCGTCTGCCGACAGTGCATTGGACTCGAAGAGCTGCATGTACGAGAGCTTGGTCACTGCGAACGCCCAGTCATCTG
CCGTCTCTTCATCGCCCTCGCGAGTGTCTGCAATCCTCACTAGCTCGTCCACCAGCTCGGTAGTGTATCCCTCGTCTGCAATGCGATCTTCGAGCGTGAG
AAAACCCTCCGAGGCCTCCACAAACAGCGGATGCAGTGGACTATCCGTCTCTTCCTCTGCGCTGGGGACCTCCTGTTTGTCGGCTACTCTGTCTTGTTGC
TGCTGCTCTGAGGAAGACGCGTGTCTGTCGATGTGGACGCCGCCGTCCTCGTTGTCCACGACGACTCTCCAGGTGCCTTCGCCGTCTCTTTGGATGATTG
TATTGAGGCCTGCAGAGGGAGTTGGAGCCTGCAATTTGCTAGAGACTGAGCCAGATGCATCGACTTCCCACGAAGCGAATTTCTGGGCCTCAACAGCGTC
TGTAGCTGCAGCTGAAGTTGTGGCGTCATCGTCGCTGAGAGCTTGTTCCTCGTGGTTCTTAGCTTGTAGGGCGTCTGCAGAGACGACGGAGGTCGCGATT
GCGCCTGCAGACAGCAGCGCTAGCGAGTATCGCTTGAGATGGCGCATGGACGCACTTCGGGGAGTGCACACGAAGGTCGAGACGACGCAGCGGGGAAGCG
GATCTGCCACGTGTGATTGGCTTGTGCTGAATATCGAAGATTCGCGGTGTACAATTGGTGGAAAAAGGAGGCGATAATGGCAGTGCTTGAGAATATAGAC
AGTGTTGGCAGATACTGACAGTGTCTTGGCGTGAAACGACGCATGCAGTGTAGCCATTTCAATACTGACGAGGGACGGAGTGGATACGGAGGAGATGACA
CACCACGGAGCGGTGCTTTATCGACGCCGCCTGGAGCAGCAGTCCACTGAAGCGAC