Description :
From Genome Similarity Track
Location :
Scaffold_34:33689- 36416
Sequence
2727 bases(100 bases per row)
GTTAATTAGTTTCAAGACGTGGTATGTCATAATCCACCGTCTGTATTACCTCGCGATAGGGGCGTACGTCATGAAATTGACTTGGTTCCTAAAACCAAAT
ACTGTGTTACACGGCGGTGGCCTTCATCAAAGAAACAGTTTGACGTCATTTACGAGTTTTTCAGGGGTAATCACGAGTCGGGAATGGTGTTTTAGAGTAA
GTCTCCTCAGTCCACACCGACATTTTGTGTCAAAAAAAACTAACGGTAAGTGGTGTATTGTGCACGCTTATAATAAGCTTAATGCGACCACTATACCGGC
ACAAACACCCTTTCCTACAAAGGACGCTCTACAGAACAACATGGCAGGATCTACAATGTACAGTGCACTCGACTTGGTCGATGGTTATTACCAATTGCTC
ATGCGAACTAGTGATGTCCCCCTTACAGCGGTTAGTACTCCAAGCGGTATGCTTTGGGAGTGGCTGGTTATGCCCCAGGGGATTTCCGATGACCGAGGCA
CGTTATATCATCTGGTGGTGCAATTGTTTCGCCATCACCGTGCGCATGCACAGACATATTTCGATGACATAGTTGTCCATAGTCGGGCAAACCAGGGTTG
GTTGGACGTGGATAACTCCATCGACCATTTACGAGCTGTACTTGAGTGAATGTGCACAAATAGGCTGTATGCTAATGCATCGAAATGTATCTTTGGTGCG
GATGAGATCCCATTTTTGGAATGCTTCATTGGGAAGCGAGGCCTTTGGACAGATCCTGCAAAAATGAAGTCCATAGTGGATTGGCCAGTTCCTAATAATC
AAAAGGACCTACGCAAATGCCTTGGCATTGCCAATTACTTGCACAGGTATAGCGAGAATTGCGCTTATATGGCTCAGCCATTATCCGATCTCCTTAAAAA
GGATGTGGAGTGGTGCTGGACTGGCACCGAATCAGAGGCTTTTAATGCCGTAAAGGAGCGTCTCCTACATGCCCCAATTTTTTTGGCTTTTCCAGATTCT
GATCAACCTTTTAGTGTCGTCTGTGACACTTCGGATTTTGCCATTGGCTGTGCTCTGGTACAAACAGGTTCTGCAGGCTTCGAGCGAGTTATCGCATTTG
ATCTCGTCAGCTGAAAGCTGCTGAAAGAACTTTTCAGTTCATGACAAAGATCTACTTGCTATAAAGTATGCACTCGTTGAATTGAGAGTTCACCTGCTTG
GCTCCAATCTTTTCGTCGTCGATAAAGATCATGCGTCTTTTGCACAGCGACCCAATCGCCTCATATCTCGCAGAGGATGTCCTTTCATTCTTGCAGAATA
TAACTTCGAGGTGAAGCATAAGCCAGGGAGGCAAAATACTTTGGCCTATGCGTTGTCACGCCGGTCTAACTATGAGCTTGCTCATGTTACAATTTTGTCA
TCGTCAATTACTGAATCAATCCGTGCATCTTATGCCAAGAATGAACAATGTGTAGCTTTGCTACGAGCTCTTGGAATCGACGAGTTTAAAGACTCGGACA
TTAAATCGTCGTCACGTTTGCGTACGAGACTACATCGTTATTCTAGCGATACCGGTTTGTTGTGCTATCGCACGGATGCTGCGGGTAGTCCGCGTATCAT
TATTCCTCATGATGAGGAACTGAAGTATCGTATCCGCTATGATTTCCACGTTACAGCAATTAGCGGACATCTCGGTCGTGAGACGACCTACAGCTTCGTT
AGACAGAGTTATTGGTGGCCCAAACTCTATAAATGGTTCAGCCCTTATGTGTGCACATGTGAGACGTCCCGAGGGTCAAACCCTCGGCACATGCGGCCGC
GCCGCTGGCTAGTTTACCTGTACCGTGTGAGGGTTGGGGGTACATCAGCATGGACTTCTTGTTTGGCCTACCGAATGATTCGGACGGTAACACAAGTATT
GTGGTTTTTATTGACCGTTTGAGCAAAATATCTTACTTAGCGGCTGTGCCGGATTCGATTGATGGTGAAGGTACAGCTTTGCTGTTCATTGATTGCGTGT
TTCGCCAACACGGACTGCCACTGGCAATTGTCTCTGACTGAGATCCTCGTTTTACGGGCAAGTTCTGGAAGGCCATCTTCAAGGTGCTCGGCACCAGATT
AGACATGTCTACCACGGATCATCCGCAGACAGATGGTCGGACTGAGCGTGTCAATCGCGTCCTCGGTGACGTCTGAAGGAGCGTGTGCGCTGAGGCGCCT
CAGCGTTGGAGCTCAATCATCCCTAGTGTTGAGTTCGCCATGAAAAATGCTGTCCGTGCCTCGACAGGCTATACTCGGTTCTACGTGAACGGCCTCACAC
ACCCGCGCGTTCCGTTGATGCTACCACTACTTGGCTCAGGGATTGGAGAAGGGGGGGCTGGCCGATCAACTTGCTGATGTTAGCCTTGCTACTGTTCAAA
ACAAAGGTCAGCGCGTTCCTAACAACGGGATTGAATTACGACATGTGCGTGACACAATGGCTGATAGCCAAGACAAACAGAAGGAACAAGTGAATGCTAA
GGCAGAAGCTGTATTAAACGTTATAAGTTCAGTGACCAAGTCTTACTAAACGCTAAAAACCTACTTACAAATGTAGTGTCTGCTGTGTTTAAGACTAAGC
TGAGTTATCGCTTCATTGGACCATTTACGGTCGTGGCCAAGAAGGGTCTTGCGTATACGCTCAACTTACTGCACATATTGCGTACACACCCCGTGTTTTA
CGTTGGCCTCCTTAAGTCGTATCGGGA