Description :
From Genome Similarity Track
Location :
Scaffold_58:336858- 344174
Sequence
7316 bases(100 bases per row)
GAGCTTCGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGTAAACAAGAAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGGCCTCACCGTGTCC
CTAGTGGGAAACCACTCATCGAACACATCCAGATGACTGTGTTCATGGACGGCCCCGCACGCACTCACCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGA
GGCGACTCAAGTGGCTCTTCAAGAAGCGTACCGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTGCCTTGTCGGCCCCCGGTCGAACA
AGCTCCAACGGACCAGTTCCTATGGAGCTCGGGTCCACCGATCAGCGGGATAGCCGCTGCTTCGGCTGCGGGAAGATGGGTCACTTCAAGCGCGACAGTC
CCGCGGAAAGACTCCGCAGACGGTCCTTCTCCAAGCCCGCTCTCAAGGGTCGCTGGCAGGAGCCAGGATCCAGGGGAACGCCGGGAACCAGTAGGGGCGG
GGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGAAAGCGCGGGTGGCGCGTACCACGGGAACTTAGCCCCTGAGAGTTTTCGCACTCTCGAACCGGC
GAAGAACAGCGGCGGGCTGCTCGTAGTACACGGATGTGTACGGAGATACGTTCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTCGCA
CGCCGCCAGACGGATGCTCGTAACAGCAACAAGTTGATCGATGCTTTGAGAGAAAGCAAGGACAACGGAACGGTGTCAGTGCGACTGGCCGACGGGAAGG
TCGTCACTGTCCCCAACGTCCAAGTGAATCTGGCCGTCAAGTTTGAAGAATTTGACAGCCTCGAACAGTTCACTATTCTCGATATGGATCCATATGATAT
GATCTTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCAGGATCGACTGGCGAGGCAAGGCAATCGGTGGCAGCCGCCCGGCACAGTCCGACAGAGCATTG
GTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCACCCGCAAGGGCTGACAGGTACCAAAGCATCCGGCAGGTGCTTGGGAGTCGTCGACGTATATGA
CGACTCCGAGGATGTTTTGATGATGACCGCGCTCAGAAAAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTTGTTCCGCAGACAGCT
GCAGCTGTCATGGACACCGAGAACAGTGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACGGAAGAGGGAGACGTCGGATACG
CTTCCTGTGTGGGTAACCCAGTGCCACACGCGGTCGCTCAGACCTTAACTGAAGAGTAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACA
CGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACCACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTA
GCGACGACATCCCTAAACGTGGGCAGCAAAGCTCCCCGTTACAGCCGCCGTCGGCAACGACGCCGCCGCCGCCTCAAGTCGGATCCAAACTTCGTTCAGA
TCGACGTCGCTTCAAGCGACTCGAAGTCCAGGGCCCGGGCCCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACGTCTTCGATGGCGAGACCGGAATACC
CGTCAAGGCATCTGGTGTCCACTTGGAACTGTTGCCAGAGGTTGTAGAGATACTGAACCTGGCGGGAATGACGGTTGAGTCTTTCCTGGCCAACTTCAAG
GCTGGATAGATTGCTGAGATGGTGCTCACGAGACCTGAGAGCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACCTAA
ACAAGCAGCGTCAGACGCACTTGGGTTCTGAGATCCTTAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACAGAGTATGCGGACGTGGTGAACAATCA
CCGATCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAAC
AGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGTGTTCGGAA
GCCGAACAGTAAGTGATGTCTGGCTCACGCTTATAACAAGCTGAACAGCGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGCTGTTGAAC
AGCATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCCACATGCGAGAGAGCGACATCCCGCTCACCGTGGTAAGCA
CTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTT
GCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCTATAGCCGTGCGAGGGAGGCAAGACGGCCATAAGGGTGCATCTAGGACACCTCCGTCGAG
TGTTGGACGTAATTCTAGGGAACAAGCTCAACGCCAACATCGACAAGTGCGTTTTCGCGTCATCAGAGATTGAAGTTCTCGGTTGCTTCGTAAGCAACGT
GGGCGTTCGGGCTAACCCAGACAAGGTCAAGGCCATAGCAGCATGACCGACGCCCCGATCCCAGAAGGATATTCGAAAGTGGTTGGGCTTGGCCAACTAC
CTTCACATGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTCCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGAGG
CTTTTGACAGCATCAAGGTCAGTCTCCAAGAGATCCCTGTCCTGGCCCTGCCGGATCAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGC
CATCGGATGTGCATAGCTGCAGACCGACACGGCTGGACAAGAACGAGTCATCTCGTTCCAGTCCAGGTAGTTCAAAGCCGCCGAGCGGAACTACCCTGTC
CACGACAAGGAGCTCCTGACAATGAAATATGTCCTTGTGAAGCTTCGTGTTCACCTTCTGGGCTCTCGGTCCTTCGTAATCTACACAGACCACGCATCCT
TGAGGACGGTGACAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAGTACAACTTCCGCGTCGAATCCAAGCCGGGCAAG
CTCAACGTGCTTGCGGACGCCCTCTCGCAGCGTCCTGATTAGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCACGGCGTA
TCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGCTCCTTATGGCAGGAGCGAGCGCAAAGGCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCAC
CCATATGAGTTGAAGGATGGCCTCCTCTATAACCGGGTGGAGCCCACAGAACCTCCACGGGTGGTCGTACCCAATGACGAGGATCTGAAGTTCGATATCC
TCGCAAAGGCGCACGACGCGCCCTCCGGCGGCCACTTGGGCCGCGAGAAGATCTTTCTGTCGGTCTCTCAGTCCTTCGGGTGGACCCATGGGCCGCCCGG
TACGTTAAGACATGCAAAACATGCCAGCGGGTCAAGCCCGCAGAACACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGA
TGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACACCTTGCTCC
GGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGTTATCACGGGCTCCCGGAGCCGATTGTCTCGGACCGAGAC
CCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACCTGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAGACGG
AGCGCGTCAATCGAGTGCTCAAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGCTGTTGAGTTTGCGCTCAA
CAACGCGGTGCACGCGTTCACGGGGCTCACGCCGTTCTACTTGAACGGCTTCCGTCACCCCAGAGTACCTCTCACGCTTCGAGGAGACACTGACTCCTCT
ATACTAAGTGGAGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCAGATGTGAGACCAGTTTCGCTGCGAAATCAAGTGGAAATTTTTATGGATACCA
ATCTGAGCGTTGTCAGCAGGGTCCGCGATGCCAGCAGCGGCCCAAGATAAACAAAAGGAGTACTCCGACAAACGTGACAGAGGAAACTTAATTTTTAAGG
TGGGAGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGC
AGTCCTGGTCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGCACCCGACGTTCTATATTGGACGTCTTAAGCGGTACTTTGATCCG
CAGGGCGTTGCTAACTCGCAGACCCACCTTGACCCAGCTCCTCAAAGTGAGGGCCGGTCACTGACGTCGACGAGGGCGTCGAAGCAGGCACCCAAGCCTC
GGTCGGAACGGCAAGGCTGCGGTCAAGCCCGTACGCCGGAGGGGTTCCGTACGAACGGACACCGGAGCCATACGCCGAGTACGCTGAGTACGCGGGGTAC
GCATCATACACGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGAACGTGGCCGCAGAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCACATCGG
AGGAAGAGGCCCGGCGATCCACCCGCAGATGCAGGCTCGCGACCTCTCGCTCCAGCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTG
GGCGGCAGCATCACCGCTAGCCCCAAAGCCAAGTGCAATCTCAAGCACGGGGACACGTTGACGAAGGCAGGCAACCTCAGGGCCCTGTGTCGGACCCGCA
GTCGGATCACTCGTACGACAGTGGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGAGCACCTCCGTCCCTGCTTGATCGGAATGGAGAAGTCCAC
TTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTGATGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGC
CGATCGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGAAACAGAAGCGGCGGCAGCTCCATAAGTAGTCCGGGGCTTCTTGCCCGAACGG
GGTACGGACGATGAATACATTTCGTACCCGCGCGCATCGTGAGCGCTGGAAGCCGCGCGCTTCAGGGTGTCCCTTGGCAGCATGCGCTTGCTGACCAAGT
GGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTAAGAGTCTC
CACCCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCCGGGGTATCCCCAAAGAGGATAGAGACCACCCCGGGTC
TCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAGAGGGGATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAACGAACAACTTTT
CTTTCTGAACAAGGGCACGTTCGTAGATGCCCCTAGAAGTGTGGCCGCCCGCAAGGCCACGAGGGGCGACGAGAAGCTCGAAGAAGAGGTCAGCCCCAGA
GCTCTCCTCGGGAGGCCAATGCCCTCTTGTGTTGATGGCAGCTCCTTGGCTGACGGGTGCCGCCACCGAGCCCCCACGCACACGCTGGGCAGCTTGGAAA
TCCTCCTGCTGCTGGTCGAGGTCATTCGTGACCTCCCGGGGCTCAGCGATAGCACCCTCCTCCTCATCTTCTTCCTCCTTCTCCTCCTCTTCATACGAGG
AGTCGAAGATGCTCCGATGGGAGTGTCGAGACTTTCTCTCTTCGCGGAGTGGAGACTTAGAGGCCGTACGCTTCTATGAGGGCTTGGCGCCTTCGGGTTT
AGAGGTTTTCTCGGCAAGCGAGAGACGTTTGCGAGGAATCTCTTCCTCATCGCCACCAGCTTTGGGAGTGCCCTTAGCCTTGACGGCCGGACTCTCAGAG
CGGACAGACGTCCTGGGACTGTGATCACCTTGATCACTTGCGAGCGACTGCACGCTGTCGTCCTTGTGCTCACTGGGGACTGGGCTGTGCCCTCTCACAG
AGCCCGCAGGAGCGTCGTGCGTGCTCTTGGACTCGACTTCGCCCTCACCGCCAGAGTCGAATTCACGTTCTACGAACCGAGGGTTCGGAGGGTTGTCTGG
AGAGGCCGAGGGCGACGGTCTGCGGCTCTTGCTTGCTCGCTTACCCACAGCCTCGTCACCCGAGGAACCGATCGCCTCGGAGGCCATTTGAGTAGCCTCC
TTCAGTGCCAAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTTCCGGCAGCAGCCTTGGAGCGTGTCTTCGCACCGCTCTTTGCAGTGCCAC
GAGGCATGATAAACGGTCGAAGTGGAGACCTAAAAGAAGAGCGCACAGATTGCTGCTCGAGGGTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGG
CCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAGCACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGAAAGGGATGTAGTG
GGGTACGCATCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACGTCATACTTCGGGATATTTGGTACAAAGTACCAAGGTCGTTCAAAGCCAACCATT
GGATTACGACATTGTATTTCTATCGGTGACATATAGTTTGTATTAAACCCAAGCTTTATCTACCTATAAATATACTCAGTTTACATTCTACCTTAATTAG
GTCACTTCGCTCTCTTTTGAATAAAGAGGGGACCTGTGAACTGTCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCT
GTGTGACCCCGTCACA