Description :
From Genome Similarity Track
Location :
contig_88:33684- 34975
Transcript NameFunction/comments
g13021.t1ETP43020.1 hypothetical protein F442_10117 [Phytophthora parasitica P10297

Sequence
1291 bases(100 bases per row)
TTTTGCGGACTTGAAAAACAGGACTCAGGCTACATCAAGCTCTCGAATCGAGTTGACACGCACTATTTCTACTGGTATTTTGAGTCTCGCAGAGAGCCGA
GCACCGACCCACTTATCTTATGGATTCCAGGTGGACCGGGGGAAGGAGGAACCTACGGATTGCTGGCGGAAAACGGCCCGTGCACAGTGAATAGCGATCA
CTCCACGACGATCAATCCATTTTCGTGGACGGCACAGGCCAACATGGTGTGGATTGACGTTCCTGCCAACTCGGGGTTCTCATATTCGACCGTCGCTGAA
GACGACGAACTCACTGATGAGCGCGTGGTCGAGAGCGTGTTCTCGTTTCTTCAAGGGTTTTTCAGGAAGCACCCCGAGCTCCAAGGACGAGAGCTTTTTA
TTGTTGGTGAGAGCTATGGGGGACACTACGTGCCATCGGTGGCGCACTACATTTGGAAGAAGCAGGGCGAGCATTTGTTCTCACCTGCGTCTCCCGAATC
TATTCCGATCAACCTTCGAGGGATCGGGATCGGCAATGGACTCACTGACCCTGTTGAAGTGTTCACTCACTTCGCCAACATTACCGACAACCGCTACAAG
ATTTTTTTCGTGAACGGCACCCAAGAAGCAGCAATGAAAGCCGCCGTTCCCGAGTGTCGACGATTGATGACTACTTGCCAATCGAACACCTCCGTTTGCG
GCGAAGCGGGCTCTTTCTGCCAGCGCACGCAGCTTATGCCGCTCCTACAAGCCCACCGGAATCCATACGATATCCGCCAAGTGTGCGCCACTTCGACGTC
GAATACTTCCGCCTGTATGGGCAAGTTCCCCTACGTGAAGGCGTATCTTGACTCGCCAGACCTGCGTACGTTCCTTGGAGTCCGACCAAGCATTGGGGGC
TGGGTCCCACTCAATCGAACTATCAATGCCGCTTTCTTCAAAGCACCGAGTTTCTCCGGGTACAAGTCTATGGGTAATAAGGTCTCCGAGTTGCTGGAAG
CAGGCTTACGTGTGCTGTTCTACGCTGGAGACGCCGATTTGCTATGTAACATCTACGCTATCGAGGCAACCGTGGAGAGGCTGATCTGGAGCGGGACCGC
CGGCTTCAACGCCGCACAAGAACGGTCGTACTCGACCACCTCTGGTATCGGTGGTGCAGGCTCTGTTCGATCGCACTCGCACTTGACGTACGTGAAAGTG
CACAACGCAGGGCACATGGCCCCTGGAGATCAACCCGAAGTTGCTCTCGACATGATCTCCAAGTTCATTCGTAACAAGCCCCTCTAAAAGA