Description :
From Genome Similarity Track
Location :
contig_88:33683- 34974
Transcript NameFunction/comments
g12489.t1hypothetical protein

Sequence
1291 bases(100 bases per row)
TTTTGCGGACTTGAAAAACAGGACTCAGGCTACATCAAGCTCTCGAATCGAGTTGACACGCACTATTTCTACTGGTATTTTGAGTCTCGCAGAGAGCCGA
GCACCGACCCACTTATCTTATGGATTCCAGGTGGACCGGGGGAAGGAGGAACCTACGGATTGCTGGCGGAAAACGGCCCGTGCACAGTGAATAGCGATCA
CTCCACGACGATCAATCCATTTTCGTGGACGGCACAGGCCAACATGGTGTGGATTGACGTTCCTGCCAACTCGGGGTTCTCATATTCGACCGTCGCTGAA
GACGACGAACTCACTGATGAGCGCGTGGTCGAGAGCGTGTTCTCGTTTCTTCAAGGGTTTTTCAGGAAGCACCCCGAGCTCCAAGGACGAGAGCTTTTTA
TTGTTGGTGAGAGCTATGGGGGACACTACGTGCCATCGGTGGCGCACTACATTTGGAAGAAGCAGGGCGAGCATTTGTTCTCACCTGCGTCTCCCGAATC
TATTCCGATCAACCTTCGAGGGATCGGGATCGGCAATGGACTCACTGACCCTGTTGAAGTGTTCACTCACTTCGCCAACATTACCGACAACCGCTACAAG
ATTTTTTTCGTGAACGGCACCCAAGAAGCAGCAATGAAAGCCGCCGTTCCCGAGTGTCGACGATTGATGACTACTTGCCAATCGAACACCTCCGTTTGCG
GCGAAGCGGGCTCTTTCTGCCAGCGCACGCAGCTTATGCCGCTCCTACAAGCTCACCGGAATCCATACGATATCCGCCAAGTGTGCGCCACTTCGACGTC
GAATACTTCCGCCTGTATGGGCAAGTTCCCCTACGTGAAGGCGTATCTTGACTCGCCAGACCTGCGTACGTTCCTTGGAGTCCGACCAAGCATTGGGGGC
TGGGTCCCACTCAATCGAACTATCAATGCCGCTTTCTTCAAAGCACCGAGTTTCTCCGGGTACAAGTCTATGGGTAATAAGGTCTCCGAGTTGCTGGAAG
CAGGCTTACGTGTGCTGTTCTACGCTGGAGACGCCGATTTGCTATGTAACATCTACGCTATCGAGGCAACCGTGGAGAAGCTGATCTGGAGCGGGACCGC
CGGCTTCAACGCCGCACAAGAACGGTCGTACTCGACCACCTCTGGTATCGGTGGTGCAGGCTCTGTTCGATCGCACTCGCACTTGACGTACGTGAAAGTG
CACAACGCAGGGCACATGGCCCCTGGAGATCAACCCGAAGTTGCTCTCGACATGATCTCCAAGTTCATTCGTAACAAGCCCCTCTAAAAGA