Description :
From Genome Similarity Track
Location :
scaffold_608:3368- 6286
Transcript NameFunction/comments
g9478.t1hypothetical protein

Sequence
2918 bases(100 bases per row)
CTGCGATTTCTGCCTCTTCGTCGTCATCTTCCTCCTCTGGAGGACTGGAATACCCGCTGTCCCTGTACCTGTTGGCTAGAGCATCCAGTTCACTTTTCTC
ACGTTCAGCCCGAGTGATTTCTTCCTCACTGCGTCGCATGGCCTCGCCCAGCTCACGTTTAGCTTCCATCAGCTGCTGCATCCGTTGCTCCAACTCCTGC
TCGTCGCTAGAGCACGCTGAGTCAACCTCTGACAATCTGTGCACATGAAGGGACCTGTCAAGTGCTGAAGAGTGCGGTCTTGAACGTCGCTGTCTGCTTT
TCCGCTTGTTAAGCTCCGATTCGAACGATTGTCCCTGCTTCTCCCGTAATTGACGCTGGCGCTCCAGAACTGTCGGTTGTGCCGGTGCAACTGACAGAAA
CATGGAGCCCATGCTGGGCTGAATCGACTCCACCGCTTCGGCAGCTGCTGTACTCCAATTCCACGGAGCCGAGACCGGTGCGAAGCCATTCATACTGGCC
TCACTGTTGTTGTCGTAGTCATAAGCCCAGTCATTCGCCCCCTGACGTTGTGTCGGCTCACTGAAGACCGACTTGCTGCGTCGTCGATAGCGCGTGTGCA
TATCCATCGAGTTGTTGGAGTAATTGGTGTTAGTGTCCCCATTGTCAATATACGGATACGCTCCTCCCGTGCGAGTGACGAGCTCCAAGGCTCTTACATT
GAGCTGCTTCTGTAGGTCATCAAAGCAGCACGCACACACTCTTTGGGGCTGGAAGAGTCCGAGATGTTTCAGTGGCACTCGATGTCTAGAGTGTCGGCCA
CACACTGAAGCTCCACAACTGCGGCAGTGGTGTCTCTGTCGGAAGTAGCCGAACTTGGCAGCACAAAGTCGACATCTCGAGGCTAGAGCCCATCTCGGAG
GAGGTGCGTGGTTCGTCAGCATTCCTGCAATCGTCTCCTCCTGCGTCATGGATCTAGAGGTGCTAAACCTCTCGGACAGCCTGTTCTCGCCTCGATCTTC
CCTCTGCTCTTCCGGTTTCGTCTCGGGCCATTGGGACGTCGGTAAGATCGTAGTAGACGGTGCACCCGTCCTCGCATGAGCTTCCAGGACGGTTAATAAC
GACAGCACGGCGCTTGAGGCCACAGGCCGCTGCTTAGCCAGCATGAGCGGCGTCTTGCCGTCCGGGGTACGTACCCCAATAGCCTTGGGGTACACGTGCA
GCAGCGCCTGAATACCTTCCAGAGCGAGTCTCTTCCTTACTGCCAAGTGCAGCGGCAATAGTCCTGCTAAATTCCGAGTAGCAGCTGCTGCCGGGTGCGC
TCGAGCCACAGTAAGTACGACGCGTGGAGGCGCCTTAGCGTCACAGCAGACCCAGTGTAACGCCGTCATCCCGAAGGCGTCGGCTGCTCTTGCTAGACGA
GGACGCAGAGCTAAAGCCACCAAGAGGCGCGGGAAGTCTCCGCTCTCTGCGAGCTTCACGGCCGCCAAAGGCGCGGCCAGTTGGTCCTCAGGCGTGAGCG
TGGGCTCCACGCGGTGGTCGGCGGGCACCTGCTGCTGGCGCTGGAGCCGCACGGGCTCCATGGTTTAGAGCTGGTCGGTAGGAAGCGCGCAAATCCCGCA
ATGGGACACTTGGGCCTGGGCTAAATCAGCGGGGCAGTATTTTAGCGCTTCAAGACGGTTCAAGATCGCATTGAAGAATCAGGTTTTAGAGGTGGTTTAA
TAAGGAAGTGGATGGATGTAGAGAGGAGTAAATTTCTGATATTATCAATGTAGGAAGGGTTAGATGGTACTGGAGTGAAAATAGATGCGTTTCATGAAGC
GTTGTGCTGCTAATTTGGACGCAGGCGGTGATTCCAATATGGGGTGGGTTGTGAGACTGATAACTCGGATCGTTTCGAGTTGCTAACGTTTCTAGCCATA
GTGTAAACTGCATTGCTGGACTGTGTGGCTGCTGTGTACACTTCACTGCCAACATGTTGCTAGGGCAAAAGCTCTCATGGAGTTCATAAAAAGGATAAGG
CTGCGGACTGCAACTTGCAGCCATTTTGTTTGGCTAGCGGTCCGTGATTGCCCGCGAAGCTTCCCGGCGAGTTCTAGGGAGGGTAAACTTCGTTTTTCTG
GAGTGTCGACACAGATCCAGCGGACCAACTTCGATCTAAGGAAAACACCAGCGATGGAGCCCTTTGCTGCTTGGCAAGCAGTGCTTGTGCAGGAGGAGTT
TTTAAATGAGTGAAAGCATCCGAAGTTGTGTTGTACTTCAAAAGAATAGTACATGTATGCGTCTTTGCTTCGATCAGTATTTTGCATGTGTTTTGTGCGT
TAGATTTCATTAAAAAAAATAATTAAGATTACCTCGTGGCTGTAGAGTTCATTTAGAACAGAGTCGTGTAGTGGGTTTCGCGATGAACGGCCCCCTTCAC
TGGTGACCAGTGACCAGTCTGGTCACCCTTTGTGCATCTTGTTATCGCGTTTGTGTTCGTGCCAGTCATCTCGCATGGATCTCGGGTCATCGTAAATTTG
AGTCAACACTGTTGATCAACAGACCCGTTGCGTGACTCGCGGAACTCTGAGGTCCTCAGTGAGGAGGGGGTTCCAGTCGTACATGCATCCGTCGGTGATA
ACTAATGAAAGACGAGGCTCTACTTGAAACTCCATTATCTGGCGAACGAAGGGTGCTCTGCTGAAATTTCTTCGGAGTGCTCCATACCTGCTACAGTGAG
ACTATCTGACTAAGAGTTGCGACTCGCCAACTTGCGAGCTCAGTCCGTAAATTAACGCGCTCCTCGCAAGTGGTTCTTACTAGTCATCTGCACTAACACT
CCACTTCTGTGTCGACTACCATGCGTTTTGTGGTACCGGCAAGTACCCTCCTGGTATTAGTGTGCGCCTTACTCGCGCAGACTATCAGCCCAACTGCTGC
TGCTGTTTCCCAAACAAC