Description :
From Genome Similarity Track
Location :
contig_88:33664- 34952
Sequence
1288 bases(100 bases per row)
TTTTGCGGACTTGAAAAACAGGACTCAGGCTACATCAAGCTCTCGAATCGAGTTGACACGCACTATTTCTACTGGTATTTTGAGTCTCGCAGAGAGCCGA
GCACCGACCCACTTATCTTATGGATTCCAGGTGGACCGGGGGAAGGAGGAACCTACGGATTGCTGGCGGAAAACGGCCCGTGCACAGTGAATAGCGATCA
CTCCACGACGATCAATCCATTTTCGTGGACGGCACAGGCCAACATGGTGTGGATTGACGTTCCTGCCAACTCGGGTTCTCATATTCGACCGTCGCTGAAG
ACGACGAACTCACTGATGAGCGCGTGGTCGAGAGCGTGTTCTCGTTTCTTCAAGGGTTTTTCAGGAAGCACCCCGAGCTCCAAGGACGAGAGCTTTTTAT
TGTTGGTGAGAGCTATGGGGGACACTACGTGCCATCGGTGGCGCACTACATTTGGAAGAAGCAGGGCGAGCATTTGTTCTCACCTGCGTCTCCCGAATCT
ATTCCGATCAACCTTCGAGGGATCGGGATCGGCAATGGACTCACTGACCCTGTTGAAGTGTTCACTCACTTCGCCAACATTACCGACAACCGCTACAAGA
TTTTTTTCGTGAACGGCACCCAAGAAGCAGCAATGAAAGCCGCCGTTCCCGAGTGTCGACGATTGATGACTACTTGCCAATCGAACACCTCCGTTTGCGG
CGAAGCGGGCTCTTTCTGCCAGCGCACGCAGCTTATGCCGCTCCTACAAGCCCACCGGAATCCATACGATATCCGCCAAGTGTGCGCCACTTCGACGTCG
AATACTTCCGCCTGTATGGGCAAGTTCCCTACGTGAAGGCGTATCTTGACTCGCCAGACCTGCGTACGTTCCTTGGAGTCCGACCAAGCATTGGGGCTGG
GTCCCACTCAATCGAACTATCAATGCCGCTTTCTTCAAAGCACCGAGTTTCTCCGGGTACAAGTCTATGGGTAATAAGGTCTCCGAGTTGCTGGAAGCAG
GCTTACGTGTGCTGTTCTACGCTGGAGACGCCGATTTGCTATGTAACATCTACGCTATCGAGGCAACCGTGGAGAGGCTGATCTGGAGCGGGACCGCCGG
CTTCAACGCCGCACAAGAACGGTCGTACTCGACCACCTCTGGTATCGGTGGTGCAGGCTCTGTTCGATCGCACTCGCACTTGACGTACGTGAAAGTGCAC
AACGCAGGGCACATGGCCCCTGGAGATCAACCCGAAGTTGCTCTCGACATGATCTCCAAGTTCATTCGTAACAAGCCCCTCTAAAAGA