Description :
From Genome Similarity Track
Location :
scaffold_933:3365- 5194
Transcript NameFunction/comments
g10641.t1 hypothetical protein PHYSODRAFT_323073

Sequence
1829 bases(100 bases per row)
CAGATGAAAGTGGCAGGCTCCTGCATTGTACGCTCACGCCTACCAACGAAATGCAGAGTCGTCGGTGACCGAGGTCGGCATCTTTGACAGTCGATCAGCA
AGGATGTCAATGCGTTGCGTAACACGTCACTACTAGTACAACTAAAGTTGGGATCTCTCTCCACTAATCCTGTAGTGGAACCTCGTGCACAGAAGAGGAC
CTACTGCCATTTTCTTTCTATTCTAATGCGTATTGACGGAATTCTTCTTAATTGCACAGCGCATGTGGCGCTAGATAACTACACGGACATGTACCCGAGG
ACACAGTGCCTCGGCGTCCACACTAATATTAGCCAATGAAATCACTCATAATGGTGTAGGAATCCGTCCTACAAATTTTACACATAACTGATTATTTCCG
TGGGCACATACCCGTATGGTACTCATGTAACCGGTATGACTGCGGTTGCACAGTGGGCCCTCCAAAACGTTTATTAGCGTGGGCACCTTGAACCGGTATG
GTACTCATGTAACCGGTATGATGGCGGTTGCACAGTTGGGCGGGCACCTTGAACCGGTATGGATGAATATACGTGTTTTTCCGACACAGAGATATACTAG
GTTGTGGTCAAGTCACTTAAATTTGCACACGAGCCAATCAGCGTTTGCCATAGTACTAATTTCAGCCAATAGTTTGTATTTTGATTGGAGTGTGCATTCA
GACAAATTCCGACAAATATTTGTCGGAATGCATGCAAAACATAGATATTTCAATACAAAATTCAAGTTTAAAACCGACAAATCAAATATTGTCGTCGTTC
CGACAGTTTGGCACACTCCTAGTCTAGGCTGAGGACAATTTGCAGTGGTGGACACTACCTGACAGCCTCTCGTATACAAGCGACAAAAGCAGAAGAGACA
CCGTCATGAGTCTCTCCTCCTTTGTTCCTGCCAACACGCAGAAAGCGCGCGCTACCGCAATCTGTGCGTTCAAGCGGATGCTACAAGTTGAGAATGTAAG
CAAGGATATCGTCCAAGCTTCTATTCTCAGCGACAACACCGGGAAATGTGTTGCGGCACTGATGGACCGGTTTGACTATCACTTAGCTACACACGAAGGT
AAGAAAGGCAAGCTCTCTCGTAACTCTGCTATCTCGTACTTTAGAAACGTGAAACTTTGGTTATTTGAACAGCATCCACATATTAGACAGCCAAGTGAAG
CTGACCTCTTGAAGAAAGGCAAAACGTTAGAAAAACACTGCATGAAACGTGACAAAGGAGGTTTTATTAACAAGGCTCCACTACGCACGAAGATTGACCT
ACGCTCGCTAACGCGCCACCTCTACTCAACGGCGGCTGTGGCTTCGGACTACGAAGATGCTGCGCTTGCTTGCCTCATGTGGCATTGCTTCGGACGTTCC
TTGAACCTCGCCTACATGAGCAAGCAGCACATAACCATGTCAGCTGATGACGTCTTCTTCATCCGCATGATTCGAGTGAAGACGTCTGAAGAACAAGGCC
TGACGCTCGTACCCGACCGCGACGATTTCCTCACATGCCCCATCTTCACGCTAGCAGTTGCCTTGGTTATGCAGGAGGCGCCATGCACGTCGTTGCTGAG
CCAGCTACCAGTGCTGTCGTCACCTGCTGCTATAGATCTTGATGCCGGTGTCGCGCTGATCGACCTGCTCCAATCTGCCGTCGCGCTGACACACCCTGCC
CAAGTTCCTGTACGCACCGCCACCTCATCCCAAGCAGCGCCCGCAAGACCAAGCCAACCTCGCGGTGAAGACGGCGTACAAGCGTACGTGAACCGCTTGT
TGAAGCGCGTGGCTGTTGCAGCGGGTACT