Description :
From Genome Similarity Track
Location :
Scaffold_30:336477- 338085
Transcript NameFunction/comments
g9740.t1POM61813.1 ABC Superfamily [Phytophthora palmivora var. palmivora

Sequence
1608 bases(100 bases per row)
CGAGTAGCATGCCAGGATAATCATGTCCGTCATGACGTTCACATCGTCCATGCCGTAGCTCTTGAGCAGATCCCACGACTCGGTCGTGTTCACCTGGGAG
AAGTGCTCGTACATGAACGACTCGAACGAGTACGTGTGGAAGGCGATGTAGTAGCCCCACTTCCAGTACACGGGCATGTCTGCGAACGGCACCATGAAGC
CTTCGCAGAGCATAAACATACCGAAGAGACCGGCTCCGAGTGCGATGCCCATAATGTAGTGTGGCACCGCAGCACCAAGCAGATGCATCAACGACTCGGC
AGCGATCAGCGACAGCGTCAGGTTCAGAAGGAACATCCCGAACGAATTGACGTTGGCCAGGAACACGACAATGGCGGACGCGAGTACCGAGATGAGTAGG
ATACCTGGCAGCGAAGCCAGCAGGTTCGACATCGTGTAGCCCGTCAGAGACAGCGCGTACGAGCGCATTTCACGCTCCATGACTGCACGGTGCTCCAGCA
GAGCGGGCAGGGCAGCGACGGACATGAACACGAGGAAAGCTTGCACGTAGAAGAGCAGCGGCACGATGGAGATATCCTTGATGTCCTTGTTCGAGCTCAG
GTACATGGTTCCCACCATCAGCGACAGCAGCACGTACATCATCACGCGCAGCCAGAAGACACCGGGATGCCGCCAGTTGTTGGTCATGTTACGCTTGACG
AGCACGAAGAACTGGTCCATAGGCCACGGCCGCATGGCCTTCAGCAGCTCCGGGTTTGCCAGGTGATCCCGGCGAGCGCGGTCTCGCACAACATCAGCAC
GGAGACGCTGCGGCTCGGTGCCTTCTTTCAGCGCTCGGACGAACGGCTCGAGTTTGAGGCCTTCGTGGAAGTTGGTGTTCACCAAGTGGACGAAGTATTC
AGCAGGGTTCGTGTACATCGGACACACGTAGCCCATGGAGAAGAAGTGGGCAATCGCAGCGTTGGTGGGTCCGCTGTACACGAGCTCACCGCTACTCAGG
ATGACCAAGTTCGTGAGCATGCCGTAGATGGACGACGAAGGCTGGTGGATAGTGCACACGACGTTCTTGCCGCCTTCCTGGCACAACCGCTCGATGTACT
GCATGACGCCACGAGCAGAAGACGAATCCAGCCCCGACGTAGGCTCGTCCAGGAGAAGAAGAGCAGGGTCCGAAAGCAGCTCCAGAGCGATACCAAGACG
CTTGCGCTGGCCAGACGAAATTCCCTTGTGGAAGACGTCACCCACGCGGGCGTTGGCGCACGTCCGCAGTCCCATAGCGTCGATCACATCCTGAACACGA
GCCTCACGCTGCACGGGGGGCATGTGGCCGGGCAGACTCAAACCGGCGCCGATCTGCAGGGTCTCCAACACCGTGAATGCTCCGAGGAACGCCATGTCTT
CGGACACGTAGTTCATGATGGAGTGGAAAGTCCGCAGGTCGCGGGGTTGTCCGTTTACTTCCACGAGACCCTCAAGGTGCACGCCCGAGCCTCCCGACGG
CACTCGGTCCGCGAGCATATCCAGCAGCGTCGTCTTACCGGCTCCCGATGGTCCAAGGATGGCCGTCAGCTCGCCAGGTCCCGATCGACCCCAAACGTTG
TTGAGGAT