Description :
From Genome Similarity Track
Location :
Scaffold_42:33646- 37675
Transcript NameFunction/comments
Physo_135940reverse transcriptase

Sequence
4029 bases(100 bases per row)
CGCCGCGTCCGAAGTCAAGACGAGTGTCTTCGGTGACCCCACGAGCCAAACGAACCCTCGGTCGGCCTTCGAATTCGTCCACTGACTTGAGTCGTGAAAC
ATGCACCACCAGGTAGAACCGGTATCCACTTCGGTCGGGTAATTCCAACTCATACGCAAACTCGTCGACCTTCTTCTTCTCGCGGAACGGTCCGTGCCAC
CGATGGGCTAGTTTCTTGGTCAGTCCTGGTCGAACCCGTTCCATGTACAGCCACACTCTGCTCCCAGGCTGCAAAGAAAGCCTCGTTCTCGTCACTGTAG
CTCCACCATGGTCAGGGGAACTCGATGCTCGGTCGACCGAGGTTCTATTCTCGCCGACGCCTGCCGTAGCTCCTTCTCCTTCCTTCCAAGTGATGCATTG
TGCTCTTCAGCTCTCCGAGCCTATTCCGCGGCTTGGTACTCCTTGGCCATCCTCAGGGCCGTTTCCTGCTGTCGGTTGACCTCTCGGCGCCATGCTAGCG
CGTCAGTTTGACAACCGAAGCCTCGTTTGAGTGACGAGGACATTGCCTTGAGCGTCGACTGTGCATCCCACCCATGAACGAGGTAAAATGGAGCTTCCTT
CCTCGTCGTATCACGGGAGTTATTGATGGCGAAGATCAGTCTTTCGGCGATCTCGTCCCAATCCTGCTGCAATGGGTCTTCAGCGTATACGCGGACTGAC
TGCATGATCGTCTTCATCGATCTCTCCTGCTGGCCGTTGGCCTGCGGTCGGTAGCTCACGGTCGCTCTCGACCGAGACTGCATCATTTCTGCGAAGGCTT
GGAAGACCTCGCTCATAAATCGAGGATCTCGGTCATGACGGATCAAGGACGGTGCCCCAAAGCGTCGGTAGACACACTCCTCAAAAGCTTGCGCAACGAG
TAAGGCAGTAGTTTCAGACATGGCTTTGCCCATCACGGATCCCGTGAACGAGCATTGGAACAGCAGGAGAGCCGTGTTGCCACGGCGACTCTTCGGTAGC
GGTATCACGAAGTCCATAGAGACTAGTTGGAAGGACCTCTCGGCTAGAATGTTCCCTGGCGAGTACCCGCGGAACTGAGGTCGGCTCTTACTTGTACTGC
AATCAGGGCACGACTTAACGTGTTTCTCCACATCGGCATACTGGACGATCCAGTAATAGTCTCTCGCCGCTCGATGTAGCGTACGGGTAATACCATGATG
ACTGCCTTCGAGTGAGTCATGACAGCTCTGCAGGACCTCTTGGATCATCGTTGTGGGTACTACGAGTCTCATCTTCAACTCGGCTTGCTCGTCGTCACTT
GAACGACGGCTCGTTCTAGTGTAATACAGCACATCGTCCTCGCTCAACACAAATTGGTCCGCCATTTTCCTTGCATCTCGTGCTGCTCTTTATCCAATCT
TCGCGTCATCTCCCCGGAGCACTGCCTTCAGATTCGACCACCGTAACTCTTCATCTTAAGCGGTGGCAATTCTCCTTTGGCGTTCTTCCTGTACTACCAG
CGGGTCAATGTCTTCCGCGTTCGGTTGGGCTGGTGACATCTCGGCGCGTAGCGGTGAAGCTCCTGCTTCATTCTGAAACTCGTTCGGCACACCATTGGCT
TCTATTCGGTGAGATGCGTCTCCCTGATCGGTGACCGAAACTTCATCTGCAAACCGGACGTGTTTCTCCTTTGCTCTCGCTTGTACGTCTGGTCGTCACA
GTCACATGTCCGGGTTCAGTCTCGTTCTGCCGTCTGTGGTCGGTTTCTCTTCGCACAAAATCGAAAAAATTCTTGCTACGAGGTTTGGCAGAAGCTACCA
CAGCCCATACTGCGTTGACCGAGGGTATGTCCTCGACGACGCAACCGTCAGCAACCTCGATGACTTCAGCGATACGGTTCAGCTTCATCAGCTCTAATAC
TGGGTCGTCCGACGATACCACCGTAGCCTTCTTGCACTCGAGAGTTTCGCTTGCCAGAGAGTTTGCCGCAGCGTTAAACTCTCTCACCACATGCAGGTAC
TTCACCGACCGAAGCTTGGCCGTGAGGATTTGGTGGTGACTGAGTTGTTGCAGCAATGACTCCTTCCGACAGGCTATCACCCCTAGGGCTTCCTGGATCG
CGAGCCTCGAGTCACCAACGACGAGTAGATCGTCGGCTCCATGCTGTAATGCAGCAGAGACGCCGTTGTTCATCCCGGTGTACTCAGCGAGGTTGACAGT
GGTGTTCTCGAGGTAAGCGCTCGCAGCAAGCACTACAGGCCACTCTGGCAGCTTCCATAGTATCCACGAGCAACTGCCATATCCACCGTTCTTCTCGGTC
TTCGCAGATCCGTCAAACGACATAACGAAGCCTCGGTAGGACCGCGGTAGGCGTGCGTAGAGCAGATGCGGGTCCAAACGAGCAGTTGCTGACCCTCGTA
TCCGGGGTGTGACCAACGCCAGTGACTTATCCAAATCAACGAAGTTCGTCAAGCCGGCTTGAAGTAGCTGGGCAAACGAACAGTCCGTTTCTTTGACTCA
TTCGACCAACAGGTGCCACGGCGATAGCAAGACGGCGAACTGGGTAGCCCGACCGAACAATGTCTTGGACTTGTGGACCCAGTCGAGTGTCGAAAACCGA
GTGTAGACCCGGATTCGCTGTCCAACGAGTTGAGTAAAACACACCTTCAGTATCAGCAGAAGCGCGAGGACCTCTTTCTCGGCCGGATGATAATTCATCT
CAGCATCCTTCAAAACACGTCCGCAGAAGCGAACGGGGTGTAGTTTGCCCTCGTGCTCATGCATCAACGTGGAACTTAGAGACCAATCGTTGGTGAACAA
CATAACATGGACTTCCTTCTTCCGGTCGAAGTATCGTAGTATCGGCGCTGCCGAAACCTTCTGTTGGAGCATCGCGAAGCTGTGCTTGGCCGCGGTGAGG
TCACCCCCCGGGCGGAAGTCCTCGTCCTTAAGCTGGTACAGCGCTGCTCCATAGACCGCAAAGTCTTGGATAAAGCGACTGTAATAGTTGAGTGCCCCAA
GGAAGGACTGCATTCATTTCTTCGTTGACGGGAACGGAAGCTCGGTCACCCCAGCCAGCATCTTATCGTCCGGTCGGATACCTTCTGCTGAGACTTCGTG
GGACAGGAAGTCTACCTTGGACTGCACAAAGATGCTCTTCGTGATGCTGATACTAATACGGCACTCTTCAAACCGTGCCAGCAATCGGCCTAGCGTCGCC
AAGCACGACTCGAAAGTCTCGGCACCGAAACAGATATCATCCACGAATGACCGGCGACTGAATACTGGTGTCAACGAGGAGTCAGCGGGCTCCCCGTTGG
CGAACATGTTGGCGATAGGGCTGTTGACCAGTTCGGCTACAGCTCCCTTACCAAGCGAGTTGTCTCGGTCGGCCTCGAACTTGGTCCGGAATGGCTTTGC
CGTACCAGTCGAAGCCTCGTTCACCCCAGCATGAGCTTCCTTGTCATGTTCTTCAGCTAGACGCATGCGCTCCGAGAATTTAAACCATTCTCCCGTCGGT
TGGACGAAGCCCCAAAGCGCGTTGTCAATCATGCGTTGATAGATCATCGGTGCGTTCTTCAGGCCGAAAGGCATACGCAACCATTCGAAGTGCCCCAGTG
CGCAGACGAAAGCAGAGATCTTCCGAGCTCGTTCGGTCATCATAATGGCCCAGAAGCCGCTAGCGGCGTCAAGCGAGCAAAACCACAAGTACGCCTCCAT
GTCCGTCAGCAAGTCATCCACCAAGGGCATGGCGTACTCCATAATCTCGGTGATCGCATTAACGAGTTTGTAGTCGATACACAGGCGGATATCCACCCCA
TTCTTCTCCAGGACGATGACGATTGGCGACGCCCATGGGCTGTCTGAGAAGGAGATAAGCCCGGCCTTCAACAGACCCTTCACCAATTCGTACAGCTTAC
CGAGGAAGCGAAGCGGGGTCCGCCGAGCCTTCTGCTTGATTGGCGCGTGCCCCTGTATATTGATGTCACACACGACACCGTAGGCTGGAGGCGGCAGGGC
GTTGCCGCTCGCAATCAAGATCTTCTCGT