Description :
From Genome Similarity Track
Location :
contig_97:33642- 34986
Transcript NameFunction/comments
g10903.t1hypothetical protein

Sequence
1344 bases(100 bases per row)
ACGACGTTAGGCGGCCAGGACGACCTGAATACTGGCGGTAAGGTGACTATCGTGTGTCAGACACGACATGGTTCAAATGCTAACGTGTCTGATGCAGGTA
CTGATAATCTCCCAAGTCACAACAGCGTATCGGAGGCTGGTGCCAGTGACCTTGTGCCTTCAGCAAGCGTATCGACTAATGCTCCACATGATGGAGGTGA
GCCGAGCTAGTATCGTGTCTTCTCATGTTTGTTACCTGACTCTATCGTGTATGATACAGTCAACCAAGGCATCGATAGACCCAGATCTCGCAGCAGCCCT
CTCATCGCGACCTCCACGCACATCGACGACAGAGACAACAGCTCCGCTGAAGCGGATGAAGAAGATGACGAGAGCATGCCAGGTACGCTGTTCGAGTACT
GCTTGACTGAACGTTGTACTCACGAACGTATTGATGTTGACACTACAGCTCCCGTCCTCTTCGGCGGCGATTGCGCAGCGAGTTCGAACATTTGCTTTCC
TCGGACAGCGAACCTGACATCCCCGAATGCTCAGATGCTGAGGGTAATAGTTCGAGACGATGTGAAGATGAAGAAACGAAAGACGACTCAACCAGCTAAG
TCCGCTCGATGGTATGCTTACGTTGTATTTCCATGTAATCGATACATGTTATTGATGCTATCGTGTACTTGGTTTTGCAGATGACCCCAACATCATCTCA
CCTGGAGATCGATTGGACAACTATACTGCGCTGGACTCGGATGGAGATAACGAAGGCGACTCCGTCTACGACGATGATGATGACCTCGGTCCGAGGAGCC
CGATCCAGTTGATGAAGATGCTCTTTACTCTCCAGACCTTCACTTTGAGCCGTCACTTCTTCAAAGAGTTGGCGGAGTTGCTGCCATCTCTCGTGGATCT
GTGGACGCACATGTTCTAACGGACATCAAGTTCAATGGATGGATCGGGCCAGAGAAGGAGACGCCGCTGCCGTACATGGACGAACCTTACGAGGAGCGAC
CAGCCAACTGGATGAGCGTAGACTATCCTAACATCTTCACTGGAGAAGGCGGACCAACACTAGAAGCGATGAAAGCAGCATCGACTGCGTTGGGGGCGTT
CTTTTTGTTTGCTCCTCCACAACTGTGGGAGACTATTGCTGGGGCCAGCGATGACTACTTCGAAGCCAATCTCGACAAGCGTGTCGCTGCTCAACACGCA
AAACAAGAGGCGCGACAACGCAAACAACCTAGCTTCCAAGTCCAGTCGCCTGCAGAGATCAAAGAGCATTTGGAGAATACACCGGAGATTTCAGGCCGCG
AGTTTTGTGTTTTTATCGGGCTGCTTATCGCACGAACTATTGCT