Description :
From Genome Similarity Track
Location :
Scaffold_26:336419- 337503
Transcript NameFunction/comments
Phyci_175346Hypothetical protein

Sequence
1084 bases(100 bases per row)
TGCTGTTGCAATGCATACAAGTACTAGGAGTCGACATAATACGCGCAACGGCAACGTGAAGTTCCTTATAATGGGATCTATGATAGGGTGAGCGTTTCGC
CGATGGGAAGGGCCTATCATGATGGCTACGCCGTTGGAGTTGCACCATACGGACACTGCCATCATGGATGCCGGTGTCATCCTTAGCGAATGTCTCTGGA
TGACCGATTCGGCAGTGAGAGTTTCGGAGAGGTGGAAATTTTAACGCAGTATAGCGTAATAGGATTGTAGGTCGATGCAAGAGGATAAATGACTGGGTAA
ATCCGTCCAAAGCGTCTATTCGTGTGATTTTAGCGACGTATCTGTTGCGTTTcggatctattgcaacgcacggccttcagcacgtagaaactgtcagtgt
ttcaactaaaaagagtgcaacgataagatagatggggataataACATTCTCGAAACAATTACTTACTTAAAAGTACTTAGTACACGTACATGTAGAGCTG
GTTGCATCGAGTCGGACGGCATCACTGTACTGAGCGATACAAAATCATTATTTGTAGTATCTACCTGGCATTGCGCCGAACGCAAATCAAAAGGCCCTGT
GATCATGAGTGCATTTTTCAAGCATCAAAATTACTGCACCCCACAAGTTCGACAGCATCGTACTGTACGTAGTGCTATTCTGAGGAACTTAAAGTTCTTC
CCTCTTCTCCTTCTCAGTTGATAAGACATGCTCAGCGAGTGCAGTGCGCGGCGGATATCCGTCGCGCCAAATGCATGTTTAGTCTTCATTGGATTCTATT
CCATTCTTTGCTgaagtcaagatataacttgtaccccggtagcggctcaactagcgctagctcttttcctgtgtacccgagcttcttgtacacggccatg
gggtccagccctgccattagccacgccttgatctgcagtttgtctgagaggtatttcagtttgactgtcttcatcaacttgctgagagcgGAGTACAGAG
CAGACAGAATTCCTCGAGCAGACTGAATTCCTATGTCTTCAATCTTGCTGAGAGCGTAGTAAAGAGCAGGTGGAATTCCTCTTT