Description :
From Genome Similarity Track
Location :
contig_37:33640- 35862
Transcript NameFunction/comments
g8880.t1hypothetical protein

Sequence
2222 bases(100 bases per row)
GGTCAACCAAACCTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTGAAGGCTCAGC
TCGCGGAGGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGGCTCTCTCGCCTTGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGGCGAGT
CACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGC
GTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTA
GCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCAT
CTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCC
GGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGCGTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTC
ACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGC
TCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCA
GTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCA
GTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATAC
CATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTC
AACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGT
GATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAAT
AGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATG
ATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGT
TTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACGTCGTCCA
CAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACG
ACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCG
CCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTC
CTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACGCGATCACGACCTTCGTGATCGAGTTGCATCAGTGCG
CATCCGATTGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGTTTGACTG
CTTCGAAGGCCTGCTGACAATC