Description :
From Genome Similarity Track
Location :
Scaffold_1575:3364- 7254
Transcript NameFunction/comments
Phyta_totarag13284hypothetical protein

Sequence
3890 bases(100 bases per row)
GGTGTGGTTTGTGACCTGGACGTAGGAAATGCACGTCCAGTGTCTCAACGCGCAAGACAAATTGCCCCACATTTGTTGGTCAAGGTTTACGAGTTACTAA
AAAAACTCCTGGAGAACGGTTTGATTGAACTATCTGAATCGGAGTGGGCCTCACCGATATTAATCGTGCTCAAGAAAAATGGAGTGGATATCAGGAGGTG
TATTGACTACCGTGTGGTGAATGAGTTCATTAAGCTGTCACGATACCCGTTACCGTTGATCGATGATCTCTTAATCGGGTTCGAGTCTGTGATGTGGTTC
ATGAGTCTGGACATGGCCAGCGGTTTCTAGGCGGTGCTCATGACTGAACGCGTCAAGCTGATCTCGGCGTTCGTTTGCCCGTTTGGACATTTCCAGTGGA
TCCGAATGCCGTTTGGGCTCAAGAATGTGCCGCTTGTTTACCAAGCAGTGATAAACAACAGCTTGTGGGGATTTGTGAGACTGCCGCCTGAGGAGGAAGC
TCTAGTTGGCCAAGATGTCTTGGAATTTTTGGAATTGAGTACACCGGATGCTGAACGCATACAGGTTCAAGACCCCGAACGTACATGCGTTGAAGGTCTC
GAACGTGGTGCGACTAAGCCCCCGATTTTGTCCGAAGAGAGGACAgtcttcaagcgcaacaCCCGTCGCCTCCACAAATGAGGCCAGTGCTTGGACGCAG
CTCATACATTGACGACATTGCGTATCGTGCCCCGACATGGGATCAGCTGTGTAAAGATCTGAGCGCACTCTTATTCAGGTTGAGATATTGGAACATTTCA
GTGAGTCTCCCAAAGAGTGAGTTTGGCAAATTGACCATTCTGTACCTTTCGCACGAGATCAACGCTGAAGGAATCCGAGCTACGCCGAAAATAGCGAAGA
GTTTCTAAGACTTACCGTTTCCGTCCACGCTCAAGGGAGTCCAGTCTTTCTTGGGGAGCTTGAACTACTACCATAAGTTCATTGAAGACCTCcttgtggt
tgctgctgtactcTATGAGTTGACTGATGAACAAGTGCGCTCAGGCAGAGATCTTGCTAGAGCCAAAGAAGCGTTCGAGATTTTGAAGCGCAAAATTGTC
TCAACGCCGTTGTTACGGCATCCTGATCGCACACGGCAGTTTATCATCATACCGCATGCCAATCCCTGGACCGCTTGTGCAGTTTTGGGTCAAATGTACG
ATGGTGTGATTCAGCCAGTTCGATTCACTGGACGCATCTTGAATGAATACGAGCTACGGTACCACATTGCTGAGAAAGAATTGTTGGCGATATTACGGAT
CTTGGAGCTATTTAGACCGCTAATATATGGTTCAGAGTACCCGATCGTGATATACACTCGCTATTCGGTACTGAGAtggttgttgaagtcgaacTCCACA
GATGGTCGGTGTCTCAAGTGGGGTCTAGAACTGTCAAAGTGGTCGTTGGAACTTCGCCGGTTTCAgcgtgatgaagatggtCTTGCCGCAATTTTAGGTG
CTGGTATCACACCCCGGGAACACTTGGACGCAGTCGCCGAAGAGCTGATTCCGGCTAAGGGACGTGTCAAACCACCACCTGCGGTCAGCATTGAAATGCT
TGAATCGGACTATCAAGGAATTGTTCTGAGCTTTGATGGTGCGGCCAAGACTTCGACGCGACAAGGAAGCTGTGGGTGCGTCTTGTGGAAATTGCCTGGG
TGGCATGTTATAGATGCACGAGGTTTTATCCTGAACGATGTAACGGTCAACGATGCTGAGTACCATGGACTGTTGAAAGGCCTGAACTTAGCTGCCGAAC
GTGATGTGCAAGACTTGGTGGCGGTTAGTGACTCACGGATTGTGATTCTACAGGCTCATGGCCTGATCAACTGCAACCAGCCTAACCTTCAACGCAGACT
TGCAGAATATGAAGtcctcaagaccaagttcaAGACTATCCGATTGGTTCACGTGAAGCGGGTATACAATCAGGCCGCAGATTATGTGACGTCCAAGACG
TTGGCGCTCGGTGAGTCGTGGCAGATTGAAGATGCGGAGGAACGCTTGCATCTGGAGCTAGTGTCTAGAATACCGGAGAAGGTTGTGAAGCCACCAGAAG
TCCTGGACGCAGATACGGCGAAAGAGGAAAGTCTGGCCACAAATGTGCGTTCAGGAACATAATCAGCCCCGTTGACACCTGCCGCCAAGGTCATGGCGGC
GCTGACACGAGCACGTTCAAGACAAGAATCGCACCAAAGGGAAGCGATGAGACCACTCGAGTACCAGGCAGAGCGCTGGCGACGAATCAAAGCGCATCAG
GGAGGAGACACCTTCTTGAAGGATGTTGCAAGCTACCTGAAGGGAGAGTTAGAGTTGTTTTCTCGTGTTCAGGTCAAGAAGATCGTCAAATATGCTGATC
AATATGTCTTGGACCCGAACGAGGTCCTCTATCGCTTGAGTGGAACTACCCGAGATCGCCCGCGTGACCGAGAATCCGAGCTGAAGATGGTTGTTCCGAC
GAGCATGCGTTCAGATATCTTGCATTACGCACACGAAGATTTCCAAGGTGGACACCAAGGCATTACTCGAACGTATAAAGAATTGCGTTCAGAGTTCTAT
TGGCCGCGGATGCTGAGATTTTCGTCAAAGAATGTACGGGTTGCGCGTCAGCCAAGGAACAGCCTCTGAACCCAGGACCGTCTCCAGGAAACATCGAGCC
TCGACGATCGTTTGAGCTTGTGTCTATGGATTTCGTTACGCACATGCCTAAGTCTGAACGCGGGAACACGTTCCTGTTACTGTTTCAAGATGCATTTTCA
GGCTTTGTGATGTGCAAACCAATGAGTTCTACAACCGCTCAAGATGTGGCTGAGGCATATGAGGAATGTGTGTTCAGGAGATTTGGAGCAAGTTCAATGT
TACGTCACGATCAAGATCCAAGGTTTGTGAGTGAAATGTTTACTCGATTCAGGGAAATGCTCGGCAGCAAACAACGCGCGACGCTCGCTTATCGCCCTCA
AGCAAATGGCCAACAAGAGCGCTCGGTTCAGACAGTTGTCCGCAGCATTAGAGCTTATGTCGCCGAAGCAGACCAAAGTGCTTGGGACGAGCACGCTGAA
CGCTTGATGTTCGCCCTGAACACATCCTTTGATGCGACCAGGCTCGAAACACCATTTTTCCTGGTTCACGGTTGGGACGCTCAAGGGACGGTCTCAACAA
TGCTTGGCCCGAAGCCGTCCAGTGTGCCTGAACGCACTGCGTATGAGTGGCGGCGAAAGCTTCAGCGTGATTACAATTATGCTCAAGCCTGCGCTGAAGA
CCTGCAAAAGAAGGCTAAGAGCCAGCGCTCGGAGTCACAAACGACGAAGTGGCGTGAATTGCCTGAACGCATCAAGGCCGGATTCAAGGTTGGAGATGCT
GTTTGGCTTTACATACCCAAGGTTCAACCTGGTCTGAGTCAGAAACTGGCCCACATGTGGCATGGCCCGTTCAGGGTTGATGAGATCCACGGCGGGTTCA
GAGTCAagctcaaggtcaaggaCACTGGGTACCGCGTTAACCCTTGGGTACACGTCAGCAGGCTGAAACCGCGAGCATTATTCCCGAAGCGCCCGGCCGA
AGAGGTTGaggtggatgaagatgatgattTTGATGCTGTTTTACTGCCAGAGGACAGTTGGGAGCCCGACACACTGAACGACGAGTACGAAGTCGAAAAG
ATTCTGGATCTACGCTGGGTCAAGCGCACTCGGACCTCTCGCCGCACTCGTGAATATCTCGTCAAGTGGCAAAATTACGACGAACCAGAGTGGTTGCCAG
TCACACAGTTGCGCTGTGGTGCCCTCCTGTATGAGTTTAGCCAAGGAGTTAGAGCGAGAGCTCGGTTTCAGGCCATGCAGGCAGGAGATG