Description :
From Genome Similarity Track
Location :
Scaffold_100:3364- 6462
Transcript NameFunction/comments
Physo_141516hypothetical protein

Sequence
3098 bases(100 bases per row)
GCTGACAACTACAAGTATATTTTGCTTCCTGACAAACTCAAGCGGAAAATTGTTCAAGCCTATACGAATGCGGGCGGGAGCACTGATCTGAATCCCGTGG
AACGAGAGGAGTTTTACGTCCTGGGCGATGGCTCCCAGCTGAGTCTCATCACTATTGACAGCAGTGACAGCAACGACCAGCCCGAAAGCGCAGTAGTTTC
GGGCCATCAAGGGCCTCACCCGGTTAGCAGAAGATCGGGAGGAGAGGGTACCCGCCGCGAGTTTGCCGCTCTTCACTCGCAGCTTGCTGCTGGACGACGA
TATATGGCGGAGGTGATGAGTGAAGTGCAGCGATTACGGCATGAAACCCAGCGGGAGATGCAAAAGGTTCAAGCGATATTGAGGCGCGTCGCAATGCAGC
CTGTCATTAGACGAGAAAACACCCCAGTCACAGTTGTTTCAGAGCCGCTGGCGAATGCAGCGAGCCCACCTTCGCGTCTACAAGTGTCTACTGCGCGTCT
ATCAAAGCGACCGAAGGATCTATTCGAGCTGTGGCACGAGTTTCAGTTCGGCTGCTGTGGATTGAAGCCAGCAAAGAACTTCACGCCGATCGAGCGGGGT
GCGAACAAGTTCGCATACTCTCGAAGAAAAGCCTTTTGGGACGTTGTGGCGAACCTCGTTCGACTAGCGATGCTGCGATCGACAAAGTGTACGTTGTGTA
TGGTAGACAGCTTTCGGTTTCGAGCATTTTGGCTGCCCTCCGCGCCGATCGTAAGCGAGGTGGTCATCCTAGCCTCCGTTCATAGATTTACTTAGTGCTC
CTGACTTGCCTTCAACTTGCCTTCTAGCGTGCGGCATTATAATTAGCCAATCAGCGCCCGGTAGCAAACCCGGTTGCACGCCCTGCTGGTATTTATACAT
TACCGGCCATTTGCAACCCCAATGTTATTTGTAGAGACGAAACGTGGCAGCGTTGATTTCGGCGATCTCGGCGACCTTCTTGACCACCCCCTACTCCTCC
AGCTTCTCGCACGCAACACTGAGCAGACTCGGGCGCTCAGGTTACGAGAAAAAATGATTTCAAGGCTACCCTTATCAATAAATTATTGTAGGATAAGTAG
TATTTGGCCGGACACCCGACCCCTATGCAAAGCTTGCCACCTCGCTGTAGCCAATCAGTGATTTTTTTCTTATCATTTGATGCTTAATTACCTATTTTCA
TCCAATCGTCGCTCATTACGGTTAGGTTTATTCCATTCCTACTTATTTCTGGAATCGTCCGGAATTTCCTGCTTCACGCAAATAAGTAATCATACAAAAC
TAAAGATGCTTCTCGTTCTTACTCGATAAGTGTTATACCTGCCGGATGTAGCCACATTCAGACTTGCCCAAGACTGACAGCGAGCTTCTCGTGGTCTCGA
CAACCGTCGCTGGAAGGTCAAGGCCGACTCCAACACGCAAACCGCTTTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAA
GCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGC
GTACATCGGAGCAGCATACGCAGGGGCCCTGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGCCA
TGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGAAGACTGCGAGTTTCTT
GATAGAGCGAGGCAACATCCTCACGAAGCCGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCGCCAAGACCGACACCAAGCGCAATCTC
GAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCG
TAGCCATGGCCGTGCTAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAAATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGC
AAGCGCCAGCTGCTCGTAAAGTGGAGTGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGAGA
TATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCT
TCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCGTTTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGAGCGAATTCGATGAGGAGCTCGCGCA
CGTCCAGGATTGCGGACAGAGTGCGATCCTCACGAAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGTTGGACGTAGCGCCAGAAGAGGTCTTCCAC
CTCGCTCCAGGTCATGTTGTCATTCGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGCCCTCCGGCTTCTTGCGAAGCGTGGTGAACT
CCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGA
ACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGGGTGCGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGATACGTGGCACTA
CCGCTTGACGAAGACTCGACAGCAGTCGCGGCAGCCGACTGCCTGGCGTGTGCCCCCGAACGAGCAGCGTGGTACTGCTCCTGCTGCTCGTCGAGGTCGT
TGGAGAGCTCCTTGGGCTCATGGACGGCACCCTCCTCGTCCTCAGACTCCGAGTCTCTGAACAGCTTGGAGCTGGAACCGCGAGGCGACCTGGAAACGGG
ACGCTTCTTCGCCCTGGCCTCTTCGGTCTTCGCAGCGGCAGCCGCCTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGGTG