Description :
From Genome Similarity Track
Location :
Scaffold_1203:3364- 5227
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1203-snap-gene-0.1Tau-tubulin kinase

Sequence
1863 bases(100 bases per row)
GGCGCATTCGACTCTTCGCCATCAGACATCTCCATCGAGCTGTCTGATCGAGCACCGCCATCATTCACGGTTTCTTCGGGAGTCGGCTGACGAGGAGTGT
CGCTGCCACTTGGAATTAGGTTGCTGCGCTGGGCGAGAGTGTTTCCGGCCCGCACCACGTTCTGCTTTTCAAGCGTCCGGCGAACTTGCAAGTCTCGCTC
TCGACGTCGCTGCAGCGCATCTGTTCGTAACTTTTGCTCCGACATGCGCCGCTTGACGAAGCTTTGAATCGGAGGTGGCAGCAGGAGGTTCGACCCGACA
CGCTTCTTTTGCTCGAGCTTGAGCACAGATTCTTGAACGTCCAGCCACTCGAGAGACTCCAAGCCGTCGCACGCGAAGAACGTATCGTACTTTGCCGCCA
TCTGGTGCCAACCCACACACAGCAGTTACTAAATACAATACCAAATATCAACAGCACACCCCAGGTGACTGGCATCTTACCTCGAGTAACCCATCCAGCA
CGGCTTGCGTAGCTGCTCCATTCAGCGCTTCAGCTGCTTTCTTCACCCACACCAACGCTCGTTCACGATCCGTCTCGAGTTCTTCCCAACCCACTTCAAA
ACCCGCCACATTCAACTCTTCTGGTTCCTGGGGACTGCCTTCTTTCTCATCATCTTCGGGCGACTCGGACAGCACGCTCTTCAAGATTAACCCAATGCGC
TTGTAGTCCGGGAGATCTTCATACTTGAGCGACTGTAAATACTTCATCAGATCCAGCAGATACGTGGCACCTTGGAGCCCTTCGACAAGCAAATTGGGAG
ACGTCTCCGTATAGTACTCCTTCAGACTCAGCACCGTCGAGCGATTCTTGAGTTGAGCGTCCGATGCCCACGGAAGCTCCCCACGCATGAAGTCCATCAC
GAGGTAAAACCACGACCACAAGTCGTCCTTTGGTCCTAGTTCCTGACGGCGGTGCGAGCTCAGCGACGCGTACATCGAAGTGCCACGGAACTCGGCCAGC
GGTCGTGCAGGGATCACCTTCTTGTTTTCGTCCAGGTGCTGCCGAGACAAACCAAAGTCGATGATGTAGTACCGCTGCCGCTGGAGTTTGTCAGCTCGGT
TCATTGCGAAATTGGACGCTTTGATGTCGCGATGCACGTAGCCATGTCGATGGAATGCTTCAATGCAGTCCAGCATCTAGAAGGAAAATAAACAGAAACA
ACAGCACTGTCAGTACAATCGGAGAGAGAACACAAACGCGCTGTGGGGAACTCACCTCCAACCCGACAGAGACACAGCGGGAGAAAGGCACGCCGTGGGC
TGCGTCGGGCGACATGCGCAGCATCGACATGCTTTCACCCAGCAACTCCATCACCAGCACCGTGCTCTCGGCATGTTTCCTGCCAGTACACACCCAAAAA
AAACCTGGTGAGATAAACTCGACAACCCTCCACTACGGATGATTGCCACAGCAATGTCGTACCCGTGGTAGTAGTACCGACACACGTGCGGACAGTCCTG
CAGGCTCTTCAGGATCACGCTCTCCCACTCGAGCACGGGTTTGAGCGAGCTTGGCGCCTCCACCTTGACGGCCACGCGGCCGCCGTCCTCAATCGAGTAT
GCCGAATAAATCTGACTAAATGTGCCCTGCGCCACGCAACAATATCAAACATTAGGCGTCTAACAGATCATATCACCACCGCAAAAAGTCCAGGCATACC
TCGCCGATCTTCTCACCGATCTTCCATCGGTCCGCGATCAGCTCGCCGGGCTGCACAGCGTCCGCAAGTGTCAGTCCAGCCTCAGCGCGTCCACAAGCAC
AGACATATTTGCCTCCTTACCAGCAATATGTTCTTGTTCAGCACCTCCATCGCGCAGGCTTGT