Description :
From Genome Similarity Track
Location :
contig_38:336382- 345749
Transcript NameFunction/comments
g8384.t1hypothetical protein
g8385.t1POM57413.1 Ribonucleoside-diphosphate reductase small chain [Phytophthora palmivora var. palmivora

Sequence
9367 bases(100 bases per row)
GCTGGAAGATGATGCATTCTTGGGGCTTGCAAAACTGCGAAAACCACTGGCACTGCGACACCTTCGCCTCAGCGATAATGACGTGTCGCCTATAACGCTG
GGGGCGATCTGCAGCGCCAGTATGGATGGCGTACTGAATCTGGAGAGACTTGAACTTACCAACAACGTGCAGATTGGCGATCCGGGTATACACGCACTAA
CACCGATGCTGGCTTCCCCAAGCGCTGGACCTGTAGCGGTACTTACGCATCTAGACGTTCGCGGCTGCAATTTTGGCCTCGAAGGGGTGACCGCCTTGCT
GCTAGCGCTGGGGCGCAACAAGACGGTCAAACACTTGAACCTCGCACAAAACTTTTTCGATGTTGGATTTGGCGACGTGCTCGCCGATTTTCTGGTCACC
AACGACTCGGTCACAAATCTGCAAGCGAATGGCGTTGGATTGGGTTTGGCAGGTGTGTCTGCTCGGCTGTTGACAGCATTAGAGAAAAATACCATACTCA
CATCACTATCGTTAGGAGCGAATCGACTTCGAAATGATGGTGCGTCTGCGCTGCTGCGAGCACTCGTAAAGCGTGCTGAAACAAAGCCTTTCACGCTGGT
TGACTTGAGTGGAAATCTTCTCACGTTGAGTGGGCTTGCGATGCTCACTGATATTTTGGAGATCCCTGCTAGTGCGGATCATGCTCGCCCCGGTTACGCT
AGCAGGAGTTGTATTGACGGGCAAGGACAGGAAGTTTTGGCAGATCGTAAACGACGGCGTATCGGTAGCTTCGACTACCACAACTTGTCGAGTCCGCTTA
ACAAGCCAATCGAAGAGCTATGCTTGCTGAATAACGATTTCATCGGAATCGATGACGAGTACGCGGGTGACAGCTCGACACTAATAGAATCCATCCGTCG
CCGCGTAGGGCACCTGAAGAGTAACGAGTGGGCAATACAGCACCAAGTCTACGACGACGAAGTGTAAAGCAAATACACATATTCCGGCACTCAATATGTA
AAATCCCTGAGGAGCTTCTCACACCACTCAATGAAAGGGTGTGTTCCTCATTGCATCAATAACCCACCTAACTACACAAAGTAGGATAAGAGAAATCCAA
AGGTTCCTCCGAACCATCGACGTCGACCGTGCAGCACGAAGCATCAAAATTCACACCACGGCAATGCCACTGAGACTGTTCTTTGACGCTGCCACCTACC
TCTCGAAGGATAACGACTGCATACTCGGATAGATTCCGAATTCGCGGTCAGTGCACTGAAGCTCGCGCCATTCACGACCTTCCTTTCGCTTGATGAGTTG
GCTCTGTTTCTCTCGTAGCTCCACGATCTGCGAATTGTAAGAGTCCAGTATGTCTTGCAATGGATGAGGAGGTTCATCCTGCTCTCCATCCGAGCTAGTG
TTATCAATATCGTCCGGCACCTCAACGTCTTCGTTTAAGTCATCATCATCATCATCGTCGTCGTCGTCATCCTCTCCTTCGTCGTAACCTTCATCTTCTC
CGACTTCGTCTTCCTCTTCATCATTGGCTTGGGAATTCTCCTCGTCCAGGCGGCGCTTCTTTGCCAAATCAAATCTCTTTCCATATTGTTCATCCTTGCC
CCGCTTGGATGGTTTCTTTGAGCTATCAGAAGTAAATTGTCGTACAAGCGGATACGGATTGTTATTGTCTTTGGAATAGTGGCCACCCTTCGCATCAGAT
ATATTGCTTGACCCCGACCCTGCAAAGGGAAAACGCACAAGATTCGTGAGATACTCCAAGAGAAAGCCACGTTTGAACTACTCATCAAACAGATTGATCC
GACGGTCTACGTACATGCGTTATCGGACGAGCCGACAGAATGGCTATCCAGACCATCATCGTCGAGGTCAGCGTCGGCATCGACTCCATCGCCCCATACA
TCTTCTTTTGCGTACCAACAACGTAAGGTAAGCTCATTAATGAAGTCGTGAGAGTAAGCAGTGAGAGTAAGCAACGTACCTGGACTGGATTGCTTTCCCC
CTGTGCTTGAGCTGTGCTCATCTGCGGCATCTTCATTGCCTGTCTGAGGCGTCTGAACTGGGGACCCGAGAAGGGGGGATTGCTCATGATCGGAGTCATC
TCCGTCCATGACAGCATCCTCGTTGCCTGTTTGGGGTGTCTGAGCTGGGGACCCAAGAGGCGAAGATTGCCCATGGCTACCTCTATCATCTTCGATAGCA
CCATTTTCAGAGTTGGCATGCTTGTTGGCATTCTCTGAAAGCGCATTGATATGCGCATCATCAGCGGTGGAGCTAGCACCAGCTTCGTAGTCAATCGCGT
GATCGTGCTGCTTCGACTCTTGTTCATCGGTCACCCCCACGGGCGTGCCTAAATTCACTGTCGGGGTAGATCCAGTGCTATCATCATTAGAAACCGCGCT
TTCGTCCTGCTTCGTTTCTTGCTCGGACCTCAGCGCCATAGACGGTATAATATCTGGTGCCACATGTATCAAAACGAGATTCTCGAAGCCATCCAACGTG
TCGAAACCTGCCCCACCATAAAAATGACACACAATTGATGATTAAGTTAAGACAGATTGGAAGTCGGCAAGAAAGCTCAAACATCGGGGTTGCGTACGTT
TTTCAAACTGGGTAAGGATATACTGGGCATCTGCGAACAAGTCTTGAAATGTGACGCCTGCACGGAAATCCCATGGTTAGCTCCGCACTAGTCACACAAT
TCAAGGATGCAAGTTTCTTTTCGAACCTGGTGTTAGGCTTGCAATTTTGGTGAAGAATGCAACCAAATTGTTGGTTCGGTACAATTCGATAGAATGTTGC
ATGCATCGAAGCACGTTATGTACCACCTCCTCAGTCCATTGGCACTGCTCTGCCACATCCCGGACAAATGCCGCATAGTCAGTTGCGGCCAAGGTACTAC
TCGGTGCTCTTTTAGAAGCTGATTGTGGCGATATACCAACTGCCCGCTCGCTTCGTAAGTTGTTTGGATGAGTAGCCCTGGAAGCAGGATTGGCTGCTGC
GATGGAAGCACCACTTTGTGCAGGCATATCCACAGTCACCTTACGAGCTGCTATCGTTGTTGAACGAAGCTTGGGCCGTGGGGCCCAGATACTTTTGCCT
TTTCGCTTTTTATTGCGCACAGACAAAATACGGAGGCCTGTAAAACATCAATCAAAGGTCTTCGTCAGCGAAATAAACTCTTGCGCTCACTTAAGAGACG
ATTCTATAACGTACACCGTGACTTGATCGCAAAATATCCAAGCGCGTAGGGATCGTTGTTGTCATTCCAATCTAATCCCAACACAAACATGGCAAAAAAA
GTTAAAAACAACCGGGCTTCTAAGCGCTTGAAAAAGTAGACAGCGAAGAGTCTGAGAGTTTTACCTGCGTTAAAGATCTTGTACGCTTCTGACGTCGGAT
CAAACACAATGCCCGGCAAATCTAAGATTTTGCAACGAGCCCAAGTCAGGTTACATCATCAAAAGCAAAACCCAGTAAAACGCATGTGCGTACTTGCTGC
GCGAACCGATGTTGACTTTTTCAAAAATTTCTCCCGCATGTCAGCTAGTTTGTTCATGCATGACCCGTCCGTTCGGTCTGACGCAAGGGAAAATATACAA
TGTCAGCGGCTATCAACATGATGAAACTGCACTGATACACTTACGCAGCGATTCGGCGACTTCGTTCACGAGGTCCGAGCTCCCATTCCTCTGGATCTCA
CTCGTGATCCGAACGAGGAAGTCAACAAGCGTCTCCATTTCTTCGGATGACCATAGTTTTGGAGCCTTACTGGGTGCTACAAGCTTTTCCTCTCGGCGAG
CCGGGGGTACCTCGGAAAATATCTCTTTCAAAAGTTCAAGGCGTGCGATCTCCACTCTCGTTCGCTCTTCACAGAAGCACGACCACATCCACAGATTTAT
CAGTCACGGTGGACGTCGAATCTGATAACCTGGAGTATCGCACTTACGACGTGAACGACGCTTCTCCCTGATGTACAACTCACGCAGCGTGTAGAACTTG
CTCTTTGACTCAGCAACCGATTTGCCTGTACATTTCCGCCAGTGCAACCAGTCACAATTTAAAGCCCGTTTGCAGTCCACGACATGCATGAAACACTCAC
CCCACAATTGAACCCGCTTGAAATACACCTCCTGGGAACGAGAAAATAGTTCTCGATACTGCTTGGCCTTCTGGAGGAAGCGACTAAGCTCGTCGGGCAG
CCACACACCGCCAGACCTGTTTTCCAGTAGCTGACTAATCGACTCGTAGATGTGCTCGTACACATACACTCGTGCCCATTCGTCGCGATAACTGCTCCAC
ACGTCACACAGAATCCCAACCAATGAGTCACCTCAACCAACAGCGCCCATTGCTCTCTCTTCGCTGCCGTGTACCTTCTGTCCGGAAGTTCTTGGTGCTC
AGCACGAGGCCGAATTGCAGCATCAGTGACCGCACCATCTCCTGGATCTCGACTGCTTTTTTACCTGCATTGCAAGACACACAAGTCAGCCTCAAGCCCC
CATTATTGACGATACCAGTACACGATCTCCAATATGTTCGTTGATCGCTCGTTCTTGACGCACCGGGCAGCTCTGCGCGCACGACCTGTGCGAACTCGGC
GTCGGACGCGTATACGTAGTGCAGCAGGTGCTTGCGGAAGAGCGACAGCAGCGCCAGGACATCGGTGTTGCCCCATCCGGGCACCCGCATCCTAGGCTTG
AAAGTCCCGTTAGCTGAAGTTGATGGGAGCTGACCAGGATAGGTGCCGAATCTGATAGTTGTAATATGAATGTTGCACGAGTGTAAATATGTTATGTACG
CACACACCAAGGGGGACTTTTTAAACTGTTTAGTGGGAAATTGGTCCAGAGCGAGCCATGTCGGACGCTGAGGACGAGCCGAGCAACCAGCGCGCGCTGC
TGATCCCCGTCAAGAACTCGGAGCAAGCGGTGGAGGTGTATGTGGACGAGCTTCCGGATGACGTCAATGACATCATCGACATCCTGCGCGCAGAGGTGGC
GCCGCTCGACGTTTGGCTGCAGTTCGCCGTACGTCCGCGTTTGATGAGACCAAACGCGGGATCAACTTTTGACAAATTGTGATTTGTGATAGGTGGAGTA
CTATAACCAGGGCCATGTTGCCCAGTTCCAGGAGATCCTGGCCGTGGCGTCCGAGCCAGGCATCGAGGAGATCTATAAAGACAATGCGTCGCGCTTGTGC
CGCATCAAGTTTTTCGTCGCGTTGGCCAGCCACGCGGTCAACGCCATGTGGAACGAGGAGGACGAGAAAAAACGCGAGGCTATCTCCCAGCGCGCCGTGG
GCTACTTCCAGCGAGCCGACCGCCTGGACCACCAGCATCCCATGACGCTCGTGGGCAAGGCGCTAATGTTTATGGCCAAGAACGAGGACGATCGCGCGGA
CCGCTTCGTCAAAAGTGTGCTCATCTCCAACAAGACCAACCTGCCGGCTATCTTGGGCAAGGCGCTGTTGCTGTACCGCAAGAAGCAGTACAAGGATGCC
AAGAAGCTCTATCTGGATGCAATCAAGCTGCACCCGCGCAGCCCCCAGGCAGCAAACATGCGCATGTGCTTTGCGTACTGCTGCTACCATTTGGGAGCTG
TGGAGAAGGCGCGCGCGGTGATGCGATTCACTGCATCGCTCGACGAGACCAACGTGGACGCAGTGATTGCTAGCGCATTGTGGCAACTTGCGAGTCAGAG
CCGCGAGGAGCGTGCCGTCAGCATCCGCGATGAAAGCTCGCGTTTCATGATGATGATCCACCACGCCCACGCTATCGACAAGACGAACCCGACGGTTCTA
AACCACCTGGCTAACCATTATTTCTCGCAGTGGATCCCGCTTCCTTGCACGGTGAGCGTGGTGCGTGGATCGGCAGTTGTGGCCACATCCAAGGATATTT
CCAATGAAGTCTCGCCAGGTCAGATTATTTGCATCGGTGACAGGTACGTTGCCTACATCAGCCGCAACGAAGATGCCGTGTCGCCGTCTGGGTTAAAGCT
GGATGGCCCGTATCGCGAAGAGTCCGCGAGCGCTACGAATATTGCACGAAAGGATTACGATAAAATGTTCACGCTTGCAGGAAATGCTTTCCACAGTACC
AAAATTCCGGAGATCCGCTCTGAAAGCTGCTACCTCATGGGACGTGGCTGCCATGCCCAGGGCAAGTACAAGGACGCTTACAGCTACTACTTCAATGCTG
GACGACTTTGGCCCAAGTTTGTGCTTCCGTGGTTTGGTCTGGCACAGATGTACTACGAGCGGAAGGAATTCACGAAGGCTGCGTCTTACTTGGAAAAGGC
TAACAAAGCGTATCCTGAAAACGTGGAAATCCTGTCCCTTCTTGGCGATGTGTACGGCAAGCTCGGCAAAAAGGACGAGGCCGTTGTTCTACTTCGTCGT
GTCGTAGAACTCGAGCCGGGCAATGTGGAGGCACTGATCGGCACGGCTGAGCTTTTGCACGGTTCTCCTGAACGAAAAGACCAGATTATCGCGATTTCAT
CGTACATTGCAGCGGAGAAGGTCATGAACAATGCCTCGGAGCGCGTACCTATGGAAGTTTATGTCAACCTGGGTGTACTTCAGCAGCGCGTTGGAAAAAT
GGCTGATGCCATTGACTGCTTCAAGAAGGCGCTCAAACAACTGGGAGATGGCAGTACTGCTGACCAAGAGAGCAAATCGGAGGAGGCTGATGCCATTGCC
GAGGAAGCCTCAAGTCCCAAGCCAACGGAGGCCAATGTCACAATCCTGTATAATATGGGACGCGTCTACGAGGAAATGGGCAACCGCGATCGTGCCAAGA
AACTCTACGATGGGATCCTAGAGGTGTTCCCCCGCTACACCGACTGCTTGCTGCGCCTAGGCTGTATGCTGCGTGATCGTGGCCAGGAGGTTGATGCGAC
GAAGATGTTTGATAAGGTACTGGAGGTGGACCCGGCGTGTGCCGAGGCCTGCCTGTTGCAGGGCAACATTCACTTGAAGAAGCGCGAGTGGGTGCTTGCT
CAGAAGAAATTCGAAAAAGTGATGGGAATGCCCGGATTGAAGAATGACCCGTATGCGTTTTTGTCCATGGGCAACATCTTCATGAGCAATCTCGGTGAAA
AGAATCGCTACACCAAGAATATGTCGCTGAGTGAAGTATACTACAAGAAAACGTTGGCGTCACACCCGCACAACATCTACGCTGCCAACGGACTCGGTAT
TATGATTGCCGAGAAGGGCAACTTCGAGCTAGCAAAACAGATTTTCTCGCAAGTGCGCGAGGCCAGTCCGGACATGCCAGATGCTTGGATTAATCTTGCG
CACATTTTCGTCGCCGAAGAGCGTTACCAAGAGGCCATTCAGCTCTACACCGTGTGCCTTACCAAGTGCTACAAAGGACAGGACCTTGAGGTACTGTTGT
ACCTTGCGAAGGCCTTTTACGAGTCAAAGGACTTCCCGAGCTGTATTTCGACGCTATCACGTGCACTGCACATGTATCCGAATGATTTGCGTCTTTGGTA
CAACACGGGCCTTGCACAGGAAGACTACGCCGTGACGACACTTGGACAGGAGACGACTAGCACGCGGTCAGGCAGTGGCAATGCAGTACCCCAACAGCGT
ACAATGGGTGATGTGCAGCGTGCCATCTTGGATTTGAAGCGAGCGCAGCGTATCTTCCGCTTCCTGCTTCAACAAGCTGAGGTTACCGGCAATAGCGGCT
CTAGTGAAAAAAAGAAACACCACAACAGTTTGCCCTTCGACAAGGAGAAGGTGTCGGAACACGAGAATTTCTGTGGCGACACCTTGACAAAGGCTAGCTA
TCACTTGGAATTCGAGCGACAAAAAGAGGAGAAGCGTCGGCTGGAGATCGAGGCTCAACGCAAGCTGCTGCGCGAGTACGAGGAGCGTGTGGCACGTGAG
CAGGAGGAAACTCGCGTAAAGGAAGACGACTTGCGCAAGCGCCACGAAGGCATCCGCCTCAAGCAGGACGAACGTTTGAAGAAATTGCACGAAGGCTGGA
GTGTGCGTGAGCGCGAGGAGGAAGAGAAAGAGAAGAAGGTTGTCAAAAAGAAAGGAGGCAAGAAGCGCAAAAAAACCGAGGACGAGGACGGCGGCTTCAT
TGACGACGCAGAGGACGAATTGGATGAGGACGGCGATAACAGCATGTCGATCGAGGACATGAAGAACCGCAACGCGACCATGAAGAAGCTGGTGGAGAAG
CGCAATAAGCGTGCGCGTGTGGGGTCTGGCTCGGAAGACGAGAAGGATGACCCCACCGGACTCTTTGGCTCTGACTCAAGTGACGATGAACAGGAATCCA
AACCAAGCGACACAATCAAGGATGATGACAAGCCTGCTGCAGAAGATGATGCGGCAGAGGATAGTCGTGAAGCTGAGAAGAACGAACTGTTCGGCTCTTC
CTCTGATGATGAGTAAGTTGCCGGATTCAGGAAGGAGGACAGTATCGACTGCGGGCCGTGCGCTACTAGTTTTCTTCATAAAACTTTTCTGATTGGCCTT
GTCGTTGATTTCTCAAAGCTTTTTTTTTACGCTCACCGAAACTTGGACTTTATATTAATTTTTGGCAATTTTTGGGAGTCGACTTGGCGCCAAAACGGAT
TTGCAACAACCAAATTTCCCGGGTTTTGATTGGCTGGGAGCGGACGTCGAGGACGAATGATGATCACATCGGCCGGACAAGTCTCCCGCGCTTTTTTCCG
CCAGCGTGGCTCGTTGGCGCGCGGCGAGCAAGTCGAGCTCTTCTGCTTGTCATTTTGGCTTTGGCGCTCTACTCCTCAAGCGACTCCTCCAGCTCCACCG
CGCAGTCGCTCAGCTTCTTCTTGCACCAAGCAAGCAAGCAGCTACCCAACCCGTCCAGATAGAATGGTCGCTGCCTCGTTGGAACGCGCTGCCGCAGACA
AGTCGCCGGAGCAGCCGGAGCAGGAGCTGAGCCCGCAGTTCGTGGAGGGTTTCGCCAAGGTAACAATGGAGAAGAAGGAGGAGCCGAAGCTCGAGATGTC
CGAGTACAAGTTGAAGGAGGTGAACGGCGAGCTGCAGCCGGAGCCGTTCCTGTGGAGAACCCGAACCGGTTCGTGCTGTTCCCGATCCAGGAGCACGACG
TGTGGCAGATGTACAAGAAGGCGGAGGCGTCGTTCTGGACGGCCGAGGAGCTGGACCTGGTGCACGACCTGAAGGACTGGGGGAACCTGACGGACAACGA
GCGCCACTTCATCAAGCACGTGCTGGCATTCTTCGCTGCCAGCGACGGCATCGTGAACGAGAACCTGGCGATGAACTTCAGCAATGAGGTGCAAGTGCCG
GAGGCTCGCTGCTTCTACGGCTTCCAGATCGCCATCGAGAACATCCACTCGGAGGTGTACTCGCTGC