Description :
From Genome Similarity Track
Location :
Scaffold_46:336380- 340832
Transcript NameFunction/comments
Hyaar_Emoy2806155GK15001 putative

Sequence
4452 bases(100 bases per row)
GGGAGAGGTCGGCCGAAACCACCGCCCGAAACCTGCGTCCGCTAACACTCCTCCTCGGCTGGCGCACTCCCCGCGGTGTCAGCTGGTGACGCGTCGCCTA
CTCCAACTGGAACAGTTCCCTCAGATCCGTCAATCGTGGAGCAGGCAATGCCTTCGTGAGCAGATCAGCCATCATGAACTTCGACTCGATGTACCGTTGT
TTGACGATATTGTGTAATCACAAATGAACTTGATTCGAACGTCCACGTGCTTGGTGCTGGACATGCTGCCCTCCGCTTCGAGATGTCGAATTGCGGCCTG
ATTGTCCATATACATGGGCATCGGCTCGTGCACTGCCTGCTCGATCTCTTGCAGCTGCTCGCGGGTTCCCAAGAGCTCACGCCCCACATGCGAGGCCGAC
GTAAATTCGGCCTCTTGGTAGACAAAGACACACCAGTATGCTTTTTGCAGATCCAATGGATGGCGGCTCCATCCAACGTGATCACTCCTCCAGTGAAAGA
TTTCCTGTCTGTCTTGTCAGCGGCGAAGTCGGAGTCGCTCCAACTCGCCGCCGATAGCTTGTCTCCTTTGGCAATGATCTTCATTATTAACTTGAGCTGT
TTGGTTGCCTTCAGGTAACGCGGACCCTTTTGGACAGCTTCCAGTCGCTGATGGTGGGCTTGTGAGTACGCCGCAATGCTATGTGGACTGCGAGGCACAC
GTCGGGGCGGGTGCATCGAGCCAACCACAGCAGGTTCCCCACTAGCGACTGGAAGTCGCGCACAGATGGCTTGCTCTGCGTATACCGCTGCACCTTCAAC
AACATCAGCTCTTCTTCCGTTCCATTGCTTCCATCGCTCATAGTGGAACGCACGCCGTTCACGTCAACAAGTCTGTGTTGTTCCAGTAGCTCTTCGATGG
TGGCTTGCTGGTCCAGCATGTAGGACCCATCCTTCAGCACCACGCGCATGCCCAAAAACTTGATCACCTCTCCTAGATCCTTTATGGACAGCACACTCTT
AGCTTTGAAGAAGTCGCTAACCAATACACGCTTTGATGCTGTCATCAGCAAGTCGTCGACGTAAACACCCACGATAATTGTGTCGTCACCACAATGTTTG
TAGTAGAGGCACATGTCACTCAGACAGCGATTGAATCCAGCCTCAACCAGTTTTACATGTAGCTATTCAATCCACAGACGTCTAGCTTGTTTCAACCCGT
ACAATGACTTCTTCAACTGTAGTGCCAGCTTGATCTTCATACTCACTCTATACTTGCCGAGCTCGTCCTTTGATATCTCCATGCTTTGGGGAATCGCCAG
GAATATATCCAAATGTTGTTCCTTGTCGGCTTTGACATACACGTTGGGGATATCACCATGTCTGGCTGGTTTCCCCCAACGCAGTGTGAAGACCAAAATC
AACTTTACCGTACTCAACTTCATCACGGCCGCGAAGGTCAACCCATAGTCGACACCAAAAATCTGCTCATCCGCAAGCAACTAAACGAGCTTTAAAACGC
TCGATCGACCCATCCGCGTTTTTTTGTTCTTAAAGACCTACTTCGTATGCAGAACGTGACTCTTGCGGGGAGGTGCCACAACCACTCACACATCATTATC
CTTAAGAGCCTCCAATTTTTCAGACATCGCAACCTGCCACAAGCGGCATCGCCTCTCCATAGTTCTTGGGATCTGGGTCGCGGATGCTGTTCACGCTTTC
ACCCATCTGGACCTTCCTGCTCTATTCCTTCTTTTCCGAGACAGCACCTTGGATAGCCACTGACCTTGTGCAATAACGCTCGCGTGTGCCAGGCCCTTTT
TGCGCGCTCACTTTTGACTTCTCCACAGAAATTTTTTGTGTCTGCTTGTCCGTGAGATTCACGCGCCGCAATTGCTCGTTCTGCTCCTCCAACAGAGTTT
CAACGTTCTTCACATGTTGAGTCACCACGACGACCTTGTCTCGCGGAATATAGACTCTTTAGCCCATCTCGTCACTCTTGCCGATAATGATGCCGGATCT
TCCACGTTCGCCCAATGACTTGTTCGCAGCGTCGCGATGCACCGTACATGGTGAGCCAAAGACGAAGATTTCACTCAAATCTGGTTGGTCTTAGTGAGCA
TCTCCGATGACGGTTTTTGTCCAGCGTTTGCCTTGCTCGGACTTCGGTTGAGTATATAGGCTGAATACTCAGCCGCATCTCCCCAAAAGCTTAACGGAAG
GCCGCATGCGAATACCATGCTCTGCACCATATTCATAATGGTGCGGTGCATTCTTTCAGCCTTGCCGCTGCTTGCTTGATTTCGCGGTTAGATCACTTGC
CGCGCAATTCCCGTCTCGTTGCAGAACAGGTCCATAGCGCGGTACTCGTCTCCTCCATCCGTGCGCAGCACGTGAATCCGGCAATTGTACTGTCGCTCGA
AGAAGGCCGTAAAATGCTTGAACGTTTGGGCAGCAATGTCCTTTGTCTTGGCCAGAAATATCCGACAGTAATTAGTCCGATGGTCAAAATAATTCACCAT
GTACCTGTTTCCTTGCCTGTCGCGTGGAGTCATTATTCCCTTGAGGTTTGGGCAGGTGAAACTTCCAATGACATCAATAGGCGAGTTCATTCCGGTATCC
CTGCTCGACTACCGATTCTTGGTCTGCTTTCCTTGAGCACAGGCAAGACAGTTGGTTCGCACTTTATCCGTATGCCTGAGGCTGGGACTGGGTCTGATGC
AAGCCGTATGACAGTGTCATAGTGCAGATGCCTCAGTCTTTATTGAAAATGCATCACTGAGCCCTCTTGCTCATCCACACTGGCCTTTATCTCGCCTTGG
CTTAGCGCAGCCATCAAGACGTCACCACACTCCGTTTGCCCTTTCAACCTTGGTCTCGAACAGCAAGTATATTGTTTGCTGTCTCGACATCGAATGCAGG
TGGTTCACCTCTAATATCAGTGATGATGCGGTGTTTGCCGCGGTACGCAATACCGAATCCTTTAGCCTCTAGAAACCTATAAGAAATAATATTCCTTTCC
AGGTTCTCAGCGTACTGCACATTTTGCAGGCGTACTAAGGTAGGTTTACCCAGTGCGGTAGTCATGATCACCACGCTTCCCTTCTTGGTGATGCGTAGCG
CACCTCCATTTTCAGTCACGCACTCGCTATCATAGTCCTCCGCATTCTCAAGGAGATTCGGGTCACTTACCAGGTGACGACTTGACCCGCTGTCCAGAAC
CCAGTATCCCGATCAATTGTCGAGGCATTCACTGCTAGAACGAAGTCGAACTCTTCCGCTTGGGCGCTGTCGTGCCTTCGTTGCGGACAGTCGGCTTTTA
AGTGTCCTGCCTTTCCGCACACAAAGCACTTTCTATTGTCTCGACGCAGTTGAATCACATTGACCACGTCTCTGCCAAATTGGCGCCCCTTCAATTCGAT
CTCCGTCGATTGAGCGACTGCACGAGTTTGTCTGTCTGTCTTAGACAGTCCGTCCTTGCCATATTCAGTCTTGACAGCATCGAAACTCGCATCGCAGGGT
CTTTGTAGTGAACGATATTGTCCAAAACCAGATTGTCAGCACCGCCACAAGCCTCGCTGACCGCCACCAGGTTCAAGTAGTGCTCGGTCCAGCTTCTCCG
TGAGCTCTTCGCGGCAATGAACATCTTCATAATCTGAGCGGGCGTGATTTTCGTCGCGAAGGTGTGAAGCAGGCGCTGCAATGCATGCTCCAGCGTAGGC
TCCTCTTCCCACCACTCTTCAACTTGTTGGTTGTAGTGTCGTTCTGCCATACCCTTCAGATTATGACCCAGGATATCAACCTTGATATCCTCGGACCATA
GGAACCCACACGCCCTTTCCGCGAACAGTATTTGACGGACAAAACTTTCCTCCCAGGATAGGAAACCGCTTCCCAATCTCGGTACAGCTCCTTTCCGTCA
AAAGGGTGCACACTGAGCTTCCGCTGCCTGGTATCTGGTACCCGTCCAGCTTCCACTTGCTGGTGTACAGGGAGCTGATGCTGCTGACTCGGTGGTGCCA
TGTAAACCAGTGGTGGTCCAAAATTCTGTGGCAGCACTTACTGTGGTGCTTGCACCATCTGCACGTTCTCCGACGCTCTGACGTAGCCCGGTTTTCGGAT
ACCGAAGTATGTAGCTGGCGACGACAAGCAGGGGGTTACCACCCGCGGTGGCGTCACGTCGAGGGTCTGGCGATTCATCGCTCTTCCTTGGCCCAGGGAC
GATTCAACAAACGCTGGCCTGCTGGTCCCTAAGCTGCTGCGCCTCACCCCATCGCTGCTGCGATGCCTCTAGGCGCTCCATGCGCTCTCCGAGGCCCGTG
AGAAGGTTCATCAGCCTCTCCTGCGTTTCCCTAGACTTCCTCCTTGTATTCTTCTTCCTCGTCAGCCCTTTCGCGACCGACGGCCTCACGCGTCTGCTCC
TTGGACTCATCCAAAGCAGACGTGCCTTTCGTTGGGCTCATAACCTATTAGA