Description :
From Genome Similarity Track
Location :
Scaffold_188:33638- 37719
Sequence
4081 bases(100 bases per row)
CCCAAGTAGACTCATCGTAGCCGACCCACTTAACCTAAAACTTTCGCTGGGACCGGGACGTACTCGTGTATAGTGGTAACTCGTCGTCAAGGATTGCCTC
GAATTCATACTGGTTCGTACTTGCGTCTGGTTCCCAGCTATCTTCGGGTAGTAATTCTTCGTCAAAGTCACATCGCTGAGTTTCTTCGAGGTCGGCGATT
AGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGAAAAAAAAACCTGTATCCACTCTTGTCGGGTAACAC
CAATTTATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGATGGGCTAACTTCTAGGTCAGGCCCGACTTGACTCGCTCCATA
AACAACCAGACTTGATATCCTTCTTTGAACAAGGATTCAGTGGATTCATCGCTTGGTTCTTCAACTCCGGCTTCATCATCTGCTGTGTTGGAAATGGATT
TTTTCTCCTTCTTGCTCAGTGCTTCGTTGTGTTCTCGAGCTCGTGGTGCCTTCTCTCGCACTTGGAACTCAGCTGCTAGCCGTAGGGCAACTTCTCGTTG
TCTGTTCGCTTCCCGGCGTGACTCGACCGCATCCGCCGGATTGGCTGTGCGTCCCTGTCCATGTCGTATGGAGCTCGTCATAGCCTTGAGTGTGGACTAG
GCGTCCCAGTCATAAACTAGATAGAGATGAGTCTTTCGCCGAGTCAAATCTCTTGAATTGCTGATAGCGTGTACCATCTTCTCGGTGATGTATCCCAGTC
GGCCTGGAGCGGGTCTTCCACGCAGACTCGTATAGTCTGAACCATTGTCTTGACTGACCTTTTTTGTTGACCGTTGATTTGTGGTCGGTAACTCAGCGTA
GCCCTTGATCTCGACTGCATAATCTCGGAGAACGTTTGGAACACTTCACTCATAAACCTTGGATCTCGGTCGTGTCGTATCAGAGATGGGGCTTTGAACC
GCCTGAAGACGCATTCTTCAAACACCTTGGCCACTTCGAGTGCCCCAGTGTCGTTCATAACCTTAGCGATAACGAACCCCGTGAAGTGGTCCTGGAACAG
CAGCAGTGCAGTATTTCCCCGCTAAGTTCGAGGTAAAGGAATCACGAAATCCATTGACACGACCTGAAATGAACGGTCTGACACCACATTTCCCGGCGAG
TAACCTCTCAACTGTGGCTTGCTCTTACTGGTACTGCAGTTCTCACAGGCGCTAACATGTTTCACCACGTCGGCGTAAAGACCAATCCAGTGGTAATCAG
CTTTGACTAGGTGATAAGTTCTGACGATGCCTTGATGACCCCCTTCGATCGAGTTGTGACAGTTACGAAGTATCTCGTAGATCATAGTTGACGGAATCAC
CAATCTCAATGAGAGATTCGATTCACCGAGTTTGCCCAGTCGACGCGTCTCATCTCGGCGGTATATCAGGACGTCTTCGCTAAGTATAAATCCTTCTGCG
ACCTTGCCGGCATTCTGAGCTCGACGGTTTGTAAGATCCTCAAATTCACCTCTCAGGTACGCCTTCAGATCGGCCCACCTGCGTTCTTCGTCTTGTGCCT
TCGCGATTCGTCGTCTCCGGTCAGTCTGTACAGTCACTGGATCCATCGCGTTGGCATTCTGAGCCGTCTGGGCTGACTTCACCTGCGACCTTGTTTCCGC
ATTCGGGGTCGTGCGGTTAGTCCGCCGAGTCGACGCACTGCTGGCTTGTTCGAATTCATCTCCACTGTTTTCAAACGCGGAATCGCCAGGTTCTGGTGAT
ATAGCTTCATGTTCTTGACTTCTTCCTCTGGCTCTAGCCGAGTCCTCATCAAGCTCATCTTTAAAGCGAACTCGGCGCACTCGGCTACGAGTGAATGCCG
TGACGACGGGGTTCCCGCTGGGTTGTATATGGCGTACAGCTCTTCGGCTACTCGGTATCGTTCTCAGTTCTGCTTTCCTATCCGTCCCGACAATTACTCG
TCTGGCTTTTGCTTTGGGTGCCTCTGTAGCGAGATAATCCGCCGCTGCGTTATAGTGTCGGGCTATGTGTCGATACCAGACCGAGTTGAGTCGCTTAGTG
AGATCCATGTGTCGTGCTAACTCTACTTGCAAAGCCTCCTTCTTGCATGCTATCATTCCCATGGATTGCTGGATTGCAAACCAGGGGTCACCCACGATAA
TTAAGTCAATTATCCCTCGGTCAATCGCCACCAAGACCCCATTGTTCATTCCAGTATACTCCGCATTGTTGACCGTAGTGGACGACAGGTATGCACTCGC
AGCGATTTCAATGTCCCAATTCGGAAGGCGCCACAGTATCCACGAACAACTTCCATACCCGCCGTATTTAGCTGTCTTCGCTGAGCCATCAAATGACAGC
ACACATCCCGCAAAGTCAGCTGGTATTCGAGCGTATAGCAGCTCTGTGTCCATTCGAACTGTCGCCGAGTTCTTGGAGGGAGGCGCAAGGTGCTTCAAGG
AATCGTCGAGTCCGATAAACGGGGTTATCGACGCCTGGAGCAACTGGGCGAAGTCTACATCTCGTTCGCGTACTCGCTTCACCTTCAAATCGTAGGGTGA
CAACATAACTACGAAACTGACTGCGCGGCCGTACAGCGAATTTGACTTAAACACCGACTCCAGCGTGGAGAAACGGGTGTAGACGTGTATCGTCTTTCCC
GCCAAGAGTATGTAGCACACTTTCAGCAATTGCAACAGCACGACTACTTCTTTCTCAGCGGGATGATAGCCGAGTTCATTCTCCTTTAGTACGCGTCCGC
AGAAGCGAACTGGGTGCAGCTTGTCGTCGTGCGGCTGCATCATGGTACTCCTCAGTGCCCAGGTATTGGCGTACAACATTATGTGGACTTCTTTCGCCGA
GTCGAAATGGCGCAGAATTGGAGCTTCTGCTACCCGTCTTTTGAGCTCGGCGAATGACGCTTTTGCTGACGCCAAGTCACCCCCAGGGCCAAAGTCCGTG
TCCTTTAGCTGATAGAGTACCGCTCCATAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTACGTGCACCTAGGAAGGCTTGCATCCCCTTCTTTG
ATTTTGGGAAGGCAAGCTCGGCGATCGCGGCTATCTTATTCGCATCAGCGCGTATGCCACTCGGCGTAATCTGGTGCGACAAGAAATCAACCTTGGGTTG
GACAAAGATACTCTTGGTAAAGCTGATGCTAATTCGGCATTCTATCGACCGGGCTAGTAGTCGGTCGAGTGTCTCCAGGCAAGCGTCAAACATCTCCCCT
CCAAAACATATATCATCGACAAACGACCTCCGCTTGAACACCGCAATTAAATAAGATCGGTCTGGTTCTCCATTAGCGAACATGTCGCCGTCCGGTCCGT
TGACCAGGTCTTGGACTGGATCGCAGTCAGCTTGTGATTAGTGGTCCGCTCCGAGCTTCGTTAGCTGACCTGGCGTTGAATCGCTGACCCCGCCGAGCTC
GACCCGCCGAGTTCCCGACTCGGCTTCAGCAATAGCTATTCGTTCAGTAAACAACTGCCATCCTCCCTTTGGCTGAACGTATCCCCATTGAGTTTGTTGA
TCAGTCGTTGATAAATCATTGGCGCATTCTTCAATCCAAACGGCATGCGTAACCATTCAAAGTGTCCAAGTGCACAGACGAACGCTGAGATCTGCCGAGC
TCGGCATGTCATCAAGACTGCCCAGAGTCCGCTCGCAGCATCAAGCGAGCAAAACCACAAGTAACTCTCCAATTTGGTGAGCAGGTCATCGACTAGTGGC
ATAGCGTATTCCATCGGCGTCGTAATCGCATTAGCTAGTTTATAGTCAATGCATAGCCGAATATCCACGCCATTTTTCTTGAGCACTATCACCACTGGCG
AGGCCCAAGAGCTGCCCGAGAATGATATCAACCCAGCTCGAAGCAGCCCCTTCAACAACTCGTACAGCTTGCTCAAGTGGCGGAGAGGTGTCCGCTGAGC
TCTCTGTTTAATAGGTGCGTGTCCTTGAACGTCGATGTCGCACAATGCTCCATACGCTGGAGGCGGCAGGGCATTACCATT