Description :
From Genome Similarity Track
Location :
Scaffold_127:33638- 37108
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_127-snap-gene-0.38Ankyrin repeat protein
Pytap_DAOMBR444maker-pag1_scaffold_127-snap-gene-0.39Lipase domain protein
Pytap_DAOMBR444maker-pag1_scaffold_127-snap-gene-0.40Conserved gene of unknown function

Sequence
3470 bases(100 bases per row)
CCTACGCTCTCGTCGCCAAGCTCTGGTTGGTCGAGGATCTTCCGGATGATTCCCTTTGTGATGAGCTCCGCCTTCCCGCTCTTGATACAACCACGGGCTT
AAGAAGCGTCAGCAATGTCATCAGTCCTCTACAGACACCACCAATATACCATACATGCGTACCAGCGAAGAACGGCCAGATCGCTTCCGAGATGCTGGCA
TAGTCGACTGGCGAGCGCCCTTCCGTGTCTCTGATCTTCGGATCGGCCCCTTTCTCCAACAATACGCGCACTACTTTCCCGTGCTCTTGAAACGCCGCGG
CGTGTAGTGCAGTCCATCCCGTTCCTTCATTCCGAGCACACGGGTCGGCACCTTTCTCCAGAAGAAAGCTCACCATGCCATCGTTTCCCCACAAGGCGGC
AGCACAAAGCGGCGTCGTCCCATCTGAACAGATGTACAGCACTTCAGGTCAAGCTCGAGTTCATATGAGAGTTCAAGTGCCCTACCTCGCCCCGGAGCGT
CGATGTCAGCTCCACTTTCAAGAaGAAACTCGACAGTCGATCGTGATCCGTTTGCAGCGGCTTCAGCAAAGGCAATGTGTGAGCGGATGACACCGTAGtC
TTGATCATCATGGTTGCTCATCGTTCCGGAAGaGGGAGCTCAGTTTCGTCTGGTGTGTAGAACTAGGAGAGTTCAGGGGTAAGACACAATAATAAACGAC
GGTTCAACGGCTGAGGGGAGAATTCATAGAATGCATAAGAGACTTCTAAGGGTACTGAGCTCATGCGACGTTGCTCAAATTGTCCAGGACCTTCGCCATC
GACGCTCTGTACACATGTGTTGGATGTGACGCCACTTTTCGCTTTGAAGAAACATGCAGCTTCTTTTCGACCAGACTCGGGTCGACGATGAGATTTCCTT
CTGCATCGATACTGATTTCAGTTCCGACATGTTGATACAATCCCCACTATCCAGAACACAGAACTGTTAGGTCAGATTTCACAGCATGGAGCCATTTGGC
ACGTACAAaaTCGGGCACTCCGGGGACGATGTCACCGTCCATAACTACACGGTAGCTAGTTGGAACACACTTGTTGTACTGGCGAACGAATGTCGGATTC
CCGACCCTTGGTCCACCGAAATTGTACATGCTCACCTTCATGCTCATGTTCACCGCGAAATCGTATGCTGCAAGAATCGCGAGGGAACCGCCCATGCTGT
GCCCGGTGATATACACAGACGCGCCTGGGTTTTCATCGAGAACCATTCGAATAACCTCTTTCAACTCAGTTCGGACGGAAGCGTACGCATTCCAAAATCC
TGATGCAGAAAGTCGATGTTATTAGTTCTTCATGGCGCGAAATCCTGTAAATGCATAAAACGTACCGCTGTGAACGCTTGGAAACGCAAGGTTCAAGATC
GGAATCTTGGCAGCGAAATCCTTGATCTTATCCATACAAGTTCGACCTCGGATCTTCCCTTTCGACGTGATCCACAGCACTTCTTGATGAAACTTTAAAT
TACTTTTCCAGTTCTGCTTGCTGGTTGTTCCTCGAAAAGCAATGACTAGCCGATTTTGTTTTGAATTCACCGCTACAATGACGTATGTATCCGTTGTGGC
ACCTCGGAGCTGGATAACCAACTCATATCCGTATTCATCTAACTTCAGCTCCCCGTATCCAGAAGGAGAAGGGCTCCCCGCcGGGTCGAAGTAAGCCTGC
CACGCGAGTTCTAGTAGCCACTTCGCAGTCTCTACACAGAAGAGATGTGAATCCGGAGTCAAGTAGCCGTACTCATCAAGCCGTGGACGGTCTTCTACAT
GGTAGGCTGTGGTTGCTAACAGCCCAGTTCCATCTCCAGCAGACGGCGGAAGATGGACAAACATCAGCAAATAGACGTAAACAGATAAGAAAATCAGCTT
GCCCAGAGAAGGTCTTCCGTTGTGTGACATAACAAATTCATGCACTGCAGTTTGGATGAATGACTCGAAACCGAGATGGTACCATGTCTCAAAGAGATTA
TACACTTGTAAACCCGAAAATACGAACACGTACAAAAGCACTAGAAGCGTTTCCAGAAACAGGAAGCGATAAGAAAGTTGCTGAAATCGAGTTGTCATGT
AAGGTAAGGCACGTAGATGCTCTCGCGTACGCCAACTGATTTGCATAATCCACCCGAGCCAAAAGAACATCAGCCCAAGACGAAAGAAGCCAAGTAGAAC
AAACAGCTCATTGTGATCTTGAATTGAAGCATGATCTCCGATAAAAAGCTTTGGCATTCGAAGTACAGTCATGATGATATCAACCCCAAATAAAGCCAAA
CCGAAAGCGAGTTTCGGTAAGAGCTGAAGAAATCCACCATGATAATCCATCAATTTCAACCAGAACACGTAGAAAAAGGCTTCGGCAAATGACTCGAAAG
CATCAGAGACAAACCTCGTCCGTGCACTAACTTCTCGATACCATTCGACCGTCGCGTAGATGGGATTCTGCCACAGCATTAGAACTACACCCAGCGCCAG
AACCCATTTCTGCACAGGTAGAATATCTCGCCACGCTTCGTGATAGTTGTTTATCGCAATGAACCAaCATGGAAGGgaTAAAATGgTCGATaCAAGCAGT
CCACTGCGAaTAATCAGTTCACTTACGTGAATAGCAGGTTtCCTTCGGATGCAAACCACATGTTAGCGTGAATTAGACATAGATATAACTGACTCAACGT
ACGTGTACGCAAAATCGTATGTCACGTTTGATCCGATGGCGTTCGGATACATACCCTTGAAGACCACAATCACTAGATATGATCCATACCCGCTTCCTCC
CTTCATCCcAACCACATTCGACAATGAACATCTGAAATAATGAACAGGAGGGAAATGAAATGCTTACCATATCCGGAGAAACTTCAATGAGTTtCGTTGG
GTTGCAGCTTGCTGCCGAGGGGCAGTtCACCCAGGCACTCTGGTTGTATTCCGTTGCAATCCAGTCTTTCGTGAACGGGCTGGTGGCAAAATCCACACCG
TACAGGTACATATCATACCGTAATATAAAGCTCTCATCAAGCACGTCTAGTGACATCATGCTAGGTGCCGAATTGTTTAAAGTAGCGGTGTTACCAAGTA
CTGGGTTGCGCCATGTGTTCGCCACGTGAATATTTCCATTATTTCCACCCCCTTGGCGTTGCTTGAAACTGTTAAGGAGTGCGAGTTCTGCTGCTCGCAT
CTCATTCGACAAGTCCACAAGCTCAAAAATGTTGACGCGCACTTGGATGGAACCAGCGAACCAGGATACGTTATTTACGAATGCCGACCACCGCGCGACA
CTGTTGTTCTTGTCGATGAACGTACACGGCAGCTCGTCTTCGATCGACGGCGACTCGGGTTTGCATTCCGCTCCCGGTAGCGTCACAACGGTCTCCAAAA
AGCCCTGGCTTTGAAGATACGGTAGCGCGAACGCAAACACAAACGAGAGGTACGTGAGCCATAGCACagT