Description :
From Genome Similarity Track
Location :
Scaffold_52:33636- 34836
Transcript NameFunction/comments
Physo_137215reverse transcriptase

Sequence
1200 bases(100 bases per row)
GCAGCCTTCAGCTGGCGAGATTCGAACGCAACCACGCGCTCGCGCCCCTCGGCGTCTGCTTGCAGCAGTGCACAGCCGATGGCAAAGTCCGAGGCGTCAC
AGACGACACTAAACGGACGAGCGGGGTCTGGCAAATCCAGAATAGGCGCATGAAGGAGACTGTCCTTAATGGCCGCGAACGCATCGTGATGCTCGGTGTC
CCAACACCACTCCACATCCTTCTTCAGGAGATTGGAGAGTGGCCGAGCCATCTCAGCGTAGTTCTCGCTGTACTTGTGCAAGTAATTGGCCAAGTCAAGC
CACTTGCGAAGATCCTTCTGGCTCTTCGCAAGTGGCCAGTCAACAATGGCCTTGACCTTGACCGGGTCGGCCCTCAGGCCACGCTTCCCGATGAAGCACC
CTAAGAAGGGGATCTCTTCCGCTCCGAAGATGCATTAGTCAATGTTGGCGTACAACTTGTTTTGACGCATGCATTCGAGCACAGCACGCAGGTGCTCCAC
ATGGTTCTCCATATCAGTCTTTCCGTGCTCCGCACGACTGTGGACAAAGATGTCATCGAAGTACGTTTGCGCGTACGCCCGATGGGGCCTGAAGAGCTGC
GTCACAAGACGATTAAACGTCGCTGGCGCGTTCGAAAGCCCTTGGGGCATCACCAACCACTCCCAGAGCATGTCGCTCGTCCTCATGAGCAATTGGTAAT
ATCCACCGACCAAGTCGAGCGCACTGTACATCGTACATCCTGTCATGTTGTTCTGAAGAACATCCTTCCGAGGAATCGGCGTCTGCGCCGGAATGGCATT
CAGCTCGTTGAAAGCATGCACGATACGCCACTTGCCATTCGGCTTTCTAACACAGAACGTCGGCGTAGAGTGTGGAGACTTCCTCTCACGCACCATGCCC
GCCTCGTGCTTCGCACGGAAGAACGCGTCAATGACGTCACACTACTCCTTCGGCGAGGGCCACTGCCTCGTCACGCAGTACTTCGTTCCCGGAACAAGAT
CGATTTCGTGTCGAACACCTCGATCCGGAGGTAGCCCCGAGGGCGGCTCCTTCGAGACCACGTCCTGGTAATCATTTACCACTTGATACAAGGGATCCGA
CGGGTCCTTCATGATCGCCGATCCGCTCCGCGCATTCAGCGCCTTCTTGGTGTCTTCCAGGACAGCTTCATCCAGAAGCGAGGACGAGTTCAACTCTTCT