Description :
From Genome Similarity Track
Location :
Scaffold_26:336343- 338031
Sequence
1688 bases(100 bases per row)
GCCCACTCGGCACTGCGGATAGTTCTCCGTTAGCCATTGAGCCACTCCAACATGTCCACCGATCAACGCGTCACGCACAGCTCGCCTTGTGCATCCTTCG
ATGCAGTTTTCATGCAAAAAGTAGAGAATTTCGATGTGCCCAAACCACGCGGCGCCATCCATCGCTTCGGTCGTGCAGCCCTCAGAGCGATGCTCACACA
ACCACGACACCACGTCGAGGTGACCGCAGCGGGCAGCAGCGTCCATAGCTTTCTGGGTGCATCCTTCGCTGCGGTTGAAGTGGAGGAATTGAACGACGTC
CAAGTGACCAAAACACGCCGCCGCATCCATCGCTTCAGTTGTGCAGCCTTCAGACCGATTTTCATGGAGGAACCGCACGATAGAGAGGTACCCACCGCTT
GCTGCTCGATCGATCGCCCTCTCCGTACAACCTTCACTTCGATTCTCGTGCAGGAACTTGACAATATCCAAGTGACCAGCTCCTGCTGCTGAATTTATCG
CCCAAGGGCTGCAACCCTCTCTGCGACGGGTGTGTAAGAATTGCACAATCTCTAAATGACCCTCGGCAGCCGCGTAGTCCATTGCCAAGTACGAGCAGCC
TTCGCGGCGACGCTCGTGCAAGAACTCCACAACCGCAAGGTGTCCGCCCCGCGCAGCACCATCCAGAGCATTATTCGTGCATCCTTCGTGGCGGTTTTCA
TGCAGGAACTTGACAATTTCTAGATGTCCACCGCGCGCCGCCCCATTCATCGCATCGGTAGTACAGCCCCCGCTCGTGTTAACATGCAGCCACTTCACCA
CGTCGAGATGCCCGTACTCCGCCGCATGATCCAGGACTAACGGCGAGCTATCCGACCCAGGAAGCAACAACTCCGTCTTATGCTCGTATAGCCACTGCAG
CAGTGTGAGGTCTCCACGCTTCGCCGCGAACACCATAGCGTGAACGGTACATCCTTCGCTACGATTCTCGTACAACCATTGCACCATCTGCGTGTTGCCG
TACCAAACAGCAAAGTTCATGGCGTACTTCGTGCACCCTTCGTCTCGGTTAGCAGCCAACCACTGCACAACGGGGACGTGTCCTCGAGCCCCCGCTTCGT
CCATGGCATGATGCGAACAGCCCTCCGCGCGGTTGTCATGCAACCACTGCACTACTTGGAGGTGTCCATGAGCCGCCGCTAGATCCATGGCCTTGGTGCT
GGCCTGCAACTCGGGGATCGTCTTGTGTAGCCACATGACAACTTGGAGCTGACCGTGTTCCGCTGCATGGTCCAGCACTGCTCCGTAACCATTGAAGTCC
GGGTCGTACACTGCCAACCATTGCAGCAAATGGATATCTCCTCGTTGCGCTGCCGACCGGAAGCAACTGCGATTGGAGAGCGGCCTCAGACGTCGCGAGG
TGGCGCCGAGACGCTGCAGTAGGTGCAAATAGCCATAGTCCAGCGCTTGCGGGATGTTCCAGAGCTGGGAACCGTCCAAATACACAGAGATGAGTGCTGC
AACGTGCGGGAGGAAGCCCAACGCCTCCTGCCGCTCGCGCCAAACGACCTGCACACAAGTGAGCAAAGGCGTCCGAACCGAGACCATGACGAAATACACA
ACTGATTTGAAAAAAAAACTGTTCAAAAACACGGCGAAACGGTGTGAGAATGTAAGTTTGCCAATGTCATTATTCGGGTTTGGGATCC