Description :
From Genome Similarity Track
Location :
contig_38:336340- 345705
Transcript NameFunction/comments
g8769.t1RAW41892.1 hypothetical protein PC110_g1930 [Phytophthora cactorum
g8770.t1hypothetical protein
g8771.t1hypothetical protein
g8772.t1POM57413.1 Ribonucleoside-diphosphate reductase small chain [Phytophthora palmivora var. palmivora

Sequence
9365 bases(100 bases per row)
GCCCCGAAGCTGGAACAACTGTTTCTGGAGCACAATGAGCTGGAAGATGATGCATTCTTGGGGCTTGCAAAACTGCGAAAACCACTGGCACTGCGACACC
TTCGCCTCAGCGATAATGACGTGTCGCCTATAACGCTGGGGGCGATCTGCAGCGCCAGTATGGATGGCGTACTGAATCTGGAGAGACTTGAACTTACCAA
CAACGTGCAGATTGGCGATCCGGGTATACACGCACTAACACCGATGCTGGCTTCCCCAAGCGCTGGACCTGTAGCGGTACTTACGCATCTAGACGTTCGC
GGCTGCAATTTTGGCCTCGAAGGGGTGACCGCCTTGCTGCTAGCGCTGGGGCGCAACAAGACGGTCAAACACTTGAACCTCGCACAAAACTTTTTCGATG
TTGGATTTGGCGACGTGCTCGCCGATTTTCTGGTCACCAACGACTCGGTCACAAATCTGCAAGCGAATGGCGTTGGATTGGGTTTGGCAGGTGTGTCTGC
TCGGCTGTTGACAGCATTAGAGAAAAATACCATACTCACATCACTATCGTTAGGAGCGAATCGACTTCGAAATGATGGTGCGTCTGCGCTGCTGCGAGCA
CTCGTAAAGCGTGCTGAAACAAAGCCTTTCACGCTGGTTGACTTGAGTGGAAATCTTCTCACGTTGAGTGGGCTTGCGATGCTCACTGATATTTTGGAGA
TCCCTGCTAGTGCGGATCATGCTCGCCCCGGTTACGCTAGCAGGAGTTGTATTGACGGGCAAGGACAGGAAGTTTTGGCAGATCGTAAACGACGGCGTAT
CGGTAGCTTCGACTACCACAACTTGTCGAGTCCGCTTAACAAGCCAATCGAAGAGCTATGCTTGCTGAATAACGATTTCATCGGAATCGATGACGAGTAC
GCGGGTGACAGCTCGACACTAATAGAATCCATCCGTCGCCGCGTAGGGCACCTGAAGAGTAACGAGTGGGCAATACAGCACCAAGTCTACGACGACGAAG
TGTAAAGCAAATACACATATTCCGGCACTCAATATGTAAAATTCCTGACGAGCTTCTCACACCACTCAATGAAAGGGTGTGTTCCTCATTGCATCAATAA
CCCACCTAACTACACAAAGTAGGATAAGAGAAATCCAAAGGTTCCTCCGAACCATCGACGTCGACCGTGCAGCACGCAGCATCAAAATTCACACCACGGC
AATGCCACTGAGACTGTTCTTTGACGCTGCCACCTACCTCTCGAAGGATAACGACTGCATACTCGGATAGATTCCGAATTCGCGGTCAGTGCACTGGAGC
TCGCGCCATTCACGACCTTCCTTTCGCTTGATGAGTTGGCTCTGTTTCTCTCGTAGCTCCACGATCTGCGAATTGTAAGAGTCCAGTATGTCTTGCAATG
GATGAGGAGGTTCATCCTGCTCTCCATCCGAGCTAGTGTTATCAATATCGTCCGGCACCTCAACGTCTTCGTTTAAGTCATCATCATCATCATCGTCGTC
GTCGTCATCCTCTCCTTCGTCGTAACCTTCATCTTCTCCGATTTCGTCTTCCTCTTCATCATTGGCTTGGGAATTCTCCTCGTCCAGGCGGCGCTTCTTT
GCCAAATCAAATCTCTTTCCATATTGTTCATCCTTGCCCCGCTTGGATGGTTTCTTTGAGCTATCAGAAGTAAATTGTCGTACAAGCGGATACGGATTGT
TATTGTCTTTGGAATAGTGGCCACCCTTCGCATCAGATATATTGCTTGACCCCGACCCTGCAAAGGGAAAACGCACAAGATTCGTGAGATACTCCAAGAG
ATAGCCACGTTTGAACTACTCATCAAACAGATTGATCCGACGGTCTACGTACATGCGTTATCGGACGAGCCGACAGAATGGCTATCCAGACCATCATCGT
CGAGGTCAGCGTCGGCATCGACTCCATCGCCCCATACATCTTCTTTTGCGTACCAACAACGTAAGGTAAGCTCATTAATGAAGTCGTGAGAGTAAGCAGT
GAGAGTAAGCAACGTACCTGGACTGGATTGCTTTCCCCCTGTGCTTGAGCTGTGCTCATCTGCGGCATCTTCATTGCCTGTCTGAGGCGTCTGAACTGGG
GACCCGAGAAGGGGGGATTGCTCATGATCGGAGTCATCTCCGTCCATGACAGCATCCTCGTTGCCTGTTTGGGGTGTCTGAGCTGGGGACCCAAGAGGCG
AAGATTGCCCATGGCTACCTCTATCATCTTCGATAGCACCATTTTCAGAGTTGGCATGCTTGTTGGCATTCTCTGAAAGCGCATTGATATGCGCATCATC
AGCGGTGGAGCTAGCACCAGCTTCGTAGTCAATCGCGTGATCGTGCTGCTTCGACTCTTGTTCATCGGTCACCCCCACGGGCGTGCCTAATTTCACTGTC
GGGGTAGATCCAGTGCTATCATCATTAGAAACCGCGCTTTCGTCCTGCTCCGTTTCTTGCTCGGACCTCAGCGCCATAGACGGTATAATATCTGGTGCCA
CATGTATCAAAACGAGATTCTCGAAGCCATCCAACGTGTCGAAACCTGCCCCACCATAAAAATGACACACAATTGATGATTAAGTTAAGACAGATTGGAA
GTCGGCAAGAAAGCTCAAACATCGGGGTTGCGTACGTTTTTCAAACTGGGTAAGGATATACTGGGCATCTGCGAACAAGTCTTGAAATGTGACGCCTGCA
CGGAAATCCCATGGTTAGCTCCGCACTAGTCACACAATTCAAGGATGCAAGTTTCTTTTCGAACCTGGTGTTAGGCTTGCAATTTTGGTGAAGAATGCAA
CCAAATTGTTGGTTCGGTACAATTCGATAGAATGTTGCATGCATCGAAGCACGTTATGTACCACCTCCTCAGTCCATTGGCACTGCTCTGCCACATCCCG
GACAAATGCCGCATAGTCAGTTGCGGCCAAGGTACTACTCGGTGCTCTTTTAGAAGCTGATTGTGGCGATATACCAACCGCCCGCTCGCTTCGTAAGTTG
TTTGGATGAGTAGCCCTGGAAGCAGGATTGGCTGCTGCGATGGAAGCACCACTTTGTGCAGGCATATCCACAGTCACCTTACGAGCTGCTATCGTTGTTG
AACGAAGCTTGGGCCGTGGGGCCCAGATACTTTTGCCTTTTCGCTTTTTATTGCGCACAGACAAAATACGGAGGCCTGTAAAACATCAATCAAAGGTCTT
CGTCAGCGAAATAAACTCTTGCGCTCACTTAAGAGACGATTCTATAACGTACACCGTGACTTGATCGCAAAATATCCAAGCGCGTAGGGATCGTTGTTGT
CATTCCAATCTAATCCCAACACAAACATGGCAAAAAAAGTTAAAAACAACCGGGCTTCTAAGCGCTTGAAAAAGTAGACAGCGAAGAGTCTGAGAGTTTT
ACCTGCGTTAAAGATCTTGTACGCTTCTGACGTCGGATCAAACACAATGCCCGGCAAATCTAAGATTTTGCAACGAGCCCAAGTCAGGTTACATCATCAA
AAGCAAAACCCAGTAAAACGCATGTGCGTACTTGCTGCGCGAACCGATGTTGACTTTTTCAAAAATTTCTCCCGCATGTCAGCTAGTTTGTTCATGCATG
ACCCGTCCGTTCGGTCTGACGCAAGGGAAAATATACAATGTCAGCGGCTATCAACATGATGAAACTGCACTGATACACTTACGCAGCGATTCGGCGACTT
CGTTCACGAGGTCCGAGCTCCCATTCCTCTGGATCTCACTCGTGATCCGAACGAGGAAGTCAACAAGCGTCTCCATTTCTTCGGATGACCATAGTTTTGG
AGCCTTACTGGGTGCTACAAGCTTTTCCTCTCGGCGAGCCGGGGGTACCTCGGAAAATATCTCTTTCAAAAGTTCAAGGCGTGCGATCTCCACTCTCGTT
CGCTCTTCACAGAAGCACGACCACATCCACAGATTTATCAGTCACGGTGGACGTCGAATCTGATAACCTGGAGTATCGCACTTACGACGTGAACGACGCT
TCTCCCTGATGTACAACTCACGCAGCGTGTAGAACTTGCTCTTTGACTCAGCAACCGATTTGCCTGTACATTTCCGCCAGTGCAACCAGTCACAATTTAA
AGCCCGTTTGCAGTCCACGACATGCATGAAACACTCACCCCACAATTGAACCCGCTTGAAATACACCTCCTGGGAACGAGAAAATAGTTCTCGATACTGC
TTGGCCTTCTGGAGGAAGCGACTAAGCTCGTCGGGCAGCCACACACCGCCAGACCTGTTTTCCAGTAGCTGACTAATCGACTCGTAGATGTGCTCGTACA
CATACACTCGTGCCCATTCGTCGCGATAACTGCTCCACACGTCACACAGAATCCCAACCAATGAGTCACCTCAACCAACAGCGCCCATTGCTCCCTCTTC
GCCGCCGTGTACCTTCTGTCCGGAAGTTCTTGGTGCTCAGCACGAGGCCGAATTGCAGCATCAGTGACCGCACCATCTCCTGGATCTCGACTGCTTTTTT
ACCTGCATTGCAAGACACACAAGTCAGCCTCAAGCCCCCATTATTGACGATACCAGTACACGATCTCCAATATGTTCGTTGATCGCTCGTTCTTGACGCA
CCGGGCAGCTCTGCGCGCACGACCTGTGCGAACTCGGCGTCGGACGCGTATACGTAGTGCAGCAGGTGCTTGCGGAAGAGCGACAGCAGCGCCAGGACAT
CGGTGTTGCCCCATCCGGGCACCCGCATCCTAGGCTTGAAAGTCCCGTTAGCTGAAGTTGATGGGAGCTGACCAGGATAGGTGCCGAATCTGATAGTTGT
AATATGAATGTTGCACGAGTGTAAATATGTTATGTACGCACACACCAAGGGGGACTTTTTAAACTGTTTAGTGGGAAATTGGTCCAGAGCGAGCCATGTC
GGACGCTGAGGACGAGCCGAGCAACCAGCGCGCGCTGCTGATCCCCGTCAAGAACTCGGAGCAAGCGGTGGAGGTGTATGTGGACGAGCTTCCGGATGAC
GTCAATGACATCATCGACATCCTGCGCGCAGAGGTGGCGCCGCTCGACGTTTGGCTGCAGTTCGCCGTACGTCCGCGTTTGATGAGACCAAACGCGGGAT
CAACTTTTGACAAATTGTGATTTGTGATAGGTGGAGTACTATAACCAGGGCCATGTTGCCCAGTTCCAGGAGATCCTGGCCGTGGCGTCCGAGCCAGGCA
TCGAGGAGATCTATAAAGACAATGCGTCGCGCTTGTGCCGCATCAAGTTTTTCGTCGCGTTGGCCAGCCACGCGGTCAACGCCATGTGGAACGAGGAGGA
CGAGAAAAAACGCGAGGCTATCTCCCAGCGCGCCGTGGGCTACTTCCAGCGAGCCGACCGCCTGGACCACCAGCATCCCATGACGCTCGTGGGCAAGGCG
CTAATGTTTATGGCCAAGAACGAGGACGATCGCGCGGACCGCTTCGTCAAAAGTGTGCTCATCTCCAACAAGACCAACCTGCCGGCTATCTTGGGCAAGG
CGCTGTTGCTGTACCGCAAGAAGCAGTACAAGGATGCCAAGAAGCTCTATCTGGATGCAATCAAGCTGCACCCGCGCAGCCCCCAGGCAGCAAACATGCG
CATGTGCTTTGCGTACTGCTGCTACCATTTGGGAGCTGTGGAGAAGGCGCGCGCGGTGATGCGATTCACTGCATCGCTCGACGAGACCAACGTGGACGCA
GTGATTGCTAGCGCATTGTGGCAACTTGCGAGTCAGAGCCGCGAGGAGCGTGCCGTCAGCATCCGCGATGAAAGCTCGCGTTTCATGATGATGATCCACC
ACGCCCACGCTATCGACAAGACGAACCCGACGGTTCTGAACCACCTGGCTAACCATTATTTCTCGCAGTGGATCCCGCTTCCTTGCACGGTGAGCGTGGT
GCGTGGATCGGCAGTTGTGGCCACATCCAAGGATATTTCCAATGAAGTCTCGCCAGGTCAGATTATTTGCATCGGTGACAGGTACGTTGCCTACATCAGC
CGCAACGAAGATGCCGTGTCGCCGTCTGGGTTAAAGCTGGATGGCCCGTATCGCGAAGAGTCCGCGAGCGCTACGAATATTGCACGAAAGGATTACGATA
AAATGTTCACGCTTGCAGGAAATGCTTTCCACAGTACCAAAATTCCGGAGATCCGCTCTGAAAGCTGCTACCTCATGGGACGTGGCTGCCATGCCCAGGG
CAAGTACAAGGACGCTTACAGCTACTACTTCAATGCTGGACGACTTTGGCCCAAGTTTGTGCTTCCGTGGTTTGGTCTGGCACAGATGTACTACGAGCGG
AAGGAATTCACGAAGGCTGCGTCTTACTTGGAAAAGGCTAACAAAGCGTATCCTGAAAACGTGGAAATCCTGTCCCTTCTTGGCGATGTGTACGGCAAGC
TCGGCAAAAAGGACGAGGCCGTTGTTCTACTTCGTCGTGTCGTAGAACTCGAGCCGGGCAATGTGGAGGCACTGATCGGCACGGCTGAGCTTTTGCACGG
TTCTCCTGAACGAAAAGACCAGATTATCGCGATTTCATCGTACATTGCAGCGGAGAAGGTCATGAACAATGCCTCGGAGCGCGTACCTATGGAAGTTTAT
GTCAACCTGGGTGTACTTCAGCAGCGCGTTGGAAAAATGGCTGATGCCATTGACTGCTTCAAGAAGGCGCTCAAACAACTGGGAGATGGCAGTACTGCTG
ACCAAGAGAGCAAATCGGAGGAGGCTGATGCCATTGCCGAGGAAGCCTCAAGTCCCAAGCCAACGGAGGCCAATGTCACAATCCTGTATAATATGGGACG
CGTCTACGAGGAAATGGGCAACCGCGATCGTGCCAAGAAACTCTACGATGGGATCCTAGAGGTGTTCCCCCGCTACACCGACTGCTTGCTGCGCCTAGGC
TGTATGCTGCGTGATCGTGGCCAGGAGGTTGATGCGACGAAGATGTTTGATAAGGTGCTGGAGGTGGACCCGGCGTGTGCCGAGGCCTGCCTGTTGCAGG
GCAACATTCACTTGAAGAAGCGCGAGTGGGTGCTTGCTCAGAAGAAATTCGAAAAAGTGATGGGAATGCCCGGATTGAAGAATGACCCGTATGCGTTTTT
GTCCATGGGCAACATCTTCATGAGCAATCTCGGTGAAAAGAATCGCTACACCAAGAATATGTCGCTGAGTGAAGTATACTACAAGAAAACGTTGGCGTCA
CACCCGCACAACATCTACGCTGCCAACGGACTCGGTATTATGATTGCCGAGAAGGGCAACTTCGAGCTAGCAAAACAGATTTTCTCGCAAGTGCGCGAGG
CCAGTCCGGACATGCCAGATGCTTGGATTAATCTTGCGCACATTTTCGTCGCCGAAGAGCGTTACCAAGAGGCCATTCAGCTCTACACCGTGTGCCTTAC
CAAGTGCTACAAAGGACAGGACCTTGAGGTACTGTTGTACCTTGCGAAGGCCTTTTACGAGTCAAAGGACTTCCCGAGCTGTATTTCGACGCTATCACGT
GCGCTGCACATGTATCCGAATGATTTGCGTCTTTGGTACAACACGGGCCTTGCACAGGAAGACTACGCCGTGACGACACTTGGACAGGAGACGACTAGCA
CGCGGTCAGGCAGTGGCAATGCAGTACCCCAACAGCGTACAATGGGTGATGTGCAGCGTGCCATCTTGGATTTGAAGCGAGCGCAGCGTATCTTCCGCTT
CCTGCTTCAACAAGCTGAGGTTACCGGCAATAGCGGCTCTAGTGAAAAAAAGAAACACCACAACAGTTTGCCCTTCGACAAGGAGAAGGTGTCGGAACAC
GAGAATTTCTGTGGCGACACCTTGACAAAGGCTAGCTATCACTTGGAATTCGAGCGACAAAAAGAGGAGAAGCGTCGGCTGGAGATCGAGGCTCAACGCA
AGCTGCTGCGCGAGTACGAGGAGCGTGTGGCACGTGAGCAGGAGGAAACTCGCGTAAAGGAAGACGACTTGCGCAAGCGCCACGAAGGCATCCGCCTCAA
GCAGGACGAACGTTTGAAGAAATTGCACGAAGGCTGGAGTGTGCGTGAGCGCGAGGAGGAAGAGAAAGAGAAGAAGGTTGTCAAAAAGAAAGGAGGCAAG
AAGCGCAAAAAAACCGAGGACGAGGACGGCGGCTTCATTGACGACGCAGAGGACGAATTGGATGAGGACGGCGATAACAGCATGTCGATCGAGGACATGA
AGAACCGCAACGCGACCATGAAGAAGCTGGTGGAGAAGCGCAATAAGCGTGCGCGTGTGGGGTCTGGCTCGGAAGACGAGAAGGATGACCCCACCGGACT
CTTTGGCTCTGACTCAAGTGATGATGAACAGGAATCCAAACCAAGCGACACAATCAAGGATGATGACAAGCCTGCTGCAGAAGATGATGCGGCAGAGGAT
AGTCGTGAAGCTGAGAAGAACGAACTGTTCGGCTCTTCCTCTGATGATGAGTAAGTTGCCGGATTCAGGAAGGAGGACAGTATCGACTGCGGGCCGTGCG
CTACTAGTTTTCTTCATAAAACTTTTCTGATTGGCCTTGTCGTTGATTTCTCAAAGCTTTTTTTTTACGCTCACCGAAACTTGGACTTTATATTAATTTT
TGGCAATTTTTGGGAGTCGACTTGGCGCCAAAACGGATTTGCAACAACCAAATTTCCCGGGTTTTGATTGGCTGGGAGCGGACGTCGAGGACGAATGATG
ATCACATCGGCCGGACAAGTCTCCCGCGCTTTTTTCCGCCAGCGTGGCTCGTTGGCGCGCGGCGAGCAAGTCGAGCTCTTCTGCTTGTCATTTTGGCTTT
GGCGCTCTACTCCTCAAGCGACTCCTCCAGCTCCACCGCGCAGTCGCTCAGCTTCTTCTTGCACCAAGCAAGCAAGCAGCTACCCAACCCGTCCAGATAG
AATGGTCGCTGCCTCGTTGGAACGCGCTGCCGCAGACAAGTCGCCGGAGCAGCCGGAGCAGGAGCTGAGCCCGCAGTTCGTGGAGGGTTTCGCCAAGGTA
ACAATGGAGAAGAAGGAGGAGCCGAAGCTCGAGATGTCCGAGTACAAGTTGAAGGAGGTGAACGGCGAGCTGCAGCCGGAGCCGTTCCTGTGGAGAACCC
GAACCGATTCGTGCTGTTCCCGATCCAGGAGCACGACGTGTGGCAGATGTACAAGAAGGCGGAGGCGTCGTTCTGGACGGCCGAGGAGCTGGACCTGGTG
CACGACCTGAAGGACTGGGGGAACCTGACGGACAACGAGCGCCACTTCATCAAGCACGTGCTGGCATTCTTCGCTGCCAGCGACGGCATCGTGAACGAGA
ACCTGGCGATGAACTTCAGCAATGAGGTGCAAGTGCCGGAGGCTCGCTGCTTCTACGGCTTCCAG