Description :
From Genome Similarity Track
Location :
Scaffold_4:336306- 339265
Sequence
2959 bases(100 bases per row)
TTGAAGTTATGTTTGATACTCAGTCGTAAAGGCTTATGCGACTGTATAAAGCTGAATGGGTGATTTTTAAGTACGGGCCAGTCTAAGCCTGGGACGGTTC
GGTTTGCCCCTACGAGGATGGATGGATATCAGAACGGTTGGTCAGTGTTGGTTATAAAGCACATTAGCGAAACTTAACTCAAAGTTTTTAATCTAGACAT
CATTATTCAAGCTTCATTGTAGTAGTGTTGAAATTCGATCAATGTTAACAAACGCATGAATAAAACGAGGACTATGCCTATCCCATACGTAAGGAATGAC
CGCCACTCTTCTACTTATGCCATGATTATTTTCTTTTTAATCATATTGGGTGTTTTACGTTCATCATGATCCTTAGTCGCAATATCTGGATTGTGGTTGC
GGATCGTGGTTGCCGGATTGCGCTGGCCAGATCAAAGTGACGAGATAGTGGGTGATAGATCACGGTTGCAGGATCGAGTTAGATGGGTTGCGCTTGGGGG
ACCACTGTTTCTGATCAAGGTTGTCGTATCGTATTGACCAGATCGAATAATTTGTTGCACTCGATTATATGGTCTCCCCCAAAATTTCTAAATTCGTTTG
GGCGATCACGTCTTCATTCGCAGCTTCACATTTTGTCTTGCGACCTGCCTTCCTTGTAGCCATCGCCTCCCGTTTTAATGCTAGATATATAGTGTACATA
TTCATTGCACATTGCTGTATCTGTACAAGGTATTGCCAAATATACCCCTCATGATTCCTAAGGCCAATCCCTACTTAAATCACGGCTGATAGAAGTCGCG
CTTCGGACACATTATGTGATCTTATACGGTATTTTCATAAACATCATCTGAATTGTATAACTTTCCAAAAAAATCTTGGATGGGTCGGGGATAATACAAT
TAGGTCAACCAAACAAGAAGAGAACTGCAACCATTCCAGCATAGAGTTGACCAATCATAAAGCGTTCCTCATCCAAACAGTTACCGCGATCTGCGCCAAA
TAATTCATTATCTGCTATATTACATGACCTTTTGGTACGCGTATATGCTTTCGATTATTCCAAAGCATCGTTCATGCTCATAGATTGCTGAGTTTTTATC
CCTTTCTGTGTTTTTAATAGTCTTCAGAAGTTGTCCCGTGTCGAAGGAGAGGCACTGTTTATATCGTTCGATACATTATTCGTGCTTCAAGGTAAAGTAA
CCATGATTTCGCTTTTGACTGGCCTGAACGCTCTGGTACGTTAGAGCTCCTTCCTGTCAAACAAAGCTTACCCTCAGACATGTCCACAGCAATAGTTCTA
TCTTCTGCTGGCTGCATTATCGCGTCAACTGTGCCTCGCAGTTGCTGCCCCTAAACTTGTACACCATCAAGCGGGATCCTTGGTCACAGATTTCTTCGTT
ACAAGGGAAAACATTTAGTTTTGCTGTCTTTGCGTTTCAATAATGTCACCTCGCGTTCTACGAGCTTCATCAAGCTTCATCGAGCTTCATCAATCGTGTA
ACTTAGCCTTTTTTGTCTCCAAACCAATGCATCCGGTGGCATTAGGTTATTCCTGCGTACTGAAGGAGCATCTATTTGAATTCCTTCGCTGCCAAGTTAG
TTATTTTTAGAATTATTTACATGAGGGTAGTCCTGAGTCTCTAGAGTTCATAAATGTCCATTTTAGGCTACTATTCGAAACCCAACTCACATGATGTGAC
TTCCGAGCTCGCCGTGTTCGTCACGCAATTAATGTAAACACCGCCGTAACCTCTGCTTCCACGCGCAATTAATAAGTCATGCCCTTGTTATAGATCATGC
TTCGTTTTTCTCATAATTGTAAGATCACCATTTTTGCTATTTAGTTCTCCTTTAGATTGTACAGCATGGTGTACACATGAATGATACCGCTCATTGCACG
CACCTCTGTAACCTTCTTGCTGACGAACTCGGTAATGTTTTCGGAACTTTGAAAATTCATTCAATCTTCTCACTGGTAATCATGTAGCGCACTTTGAACT
TATATCAATCATTGGTCACCTCTGTCTTACGCTTCATTAATTTCGCACCACATATCGGGCGTACATCCATTAATATCAGCACGTATCGGGTACCACCCTT
CGATACCTTACACATCGGTCTCTTTACTTCCGCGGAGCATTTCCTCCATACGCGATTGTCGTAATTACCGTGTTGGGAATATTTCAACAGTCGGATTACG
CTTTAAGCATCCGCCGCAAATCTTTTATAAAGCAGGCTGCATTCAGCTCACATTGCGCTGTGTCTTCAACAGACCGTTATAATTGAGTAATCAAAAGCAA
TAATGATAAATCTCCAATTTATCCTTGAAAACCGGCGTTCTCAGGAATATATCCTCGTTTTATTCGCCGTTCAAGACGTACACATTACGGACTTTCGCAA
TCGTACGTCTCGTATTTCGAATGATACTGGAGGATTTTCGGAGCTCAACCTTTTTGACGTAGGCTACCTATTCACTAACTAATAGGAGCCTTCATTCGAT
ACTTTAAAGCACACCACGTCAACCACCTTAATCTGCAGGCCGTCTAGTACAGTAATTTAACCGTCCTCTTTGCTGATACTTGCAGCTTCTTCCAGTCTGA
ATGATAACCTTTAGAAAATCTTTCAGAATCTCAAAATCAAATAGATCAATCCGATAAGGTGTCATGTGCGACGTGGCTCTACTGGCAATTTCTAACTGTA
ACATTTTCTTCATCCACGGCAGTTATAGTGATTTCCTACTCGGCATTGATCAATTTCCTACACTGTAGGAGGGCGCTTAAAGATGCCACGCACTAACTTA
ATACAAACATTCAGGCACCTGCGAGAAAGCGTTTTTACGGTCTTTTCTCGCGATCAGTGAGTTTTGGGTTGACCTCTTACGACTGCCCCACCGAAAGATG
TGTGCTTGTAGTGGGTATGGCTCGGACGCGGTTTCCCGTCCTCCGGCAAACACGTTACG