Description :
From Genome Similarity Track
Location :
Scaffold_1762:3363- 6994
Transcript NameFunction/comments
Phyta_totarag13617hypothetical protein
Phyta_totarag13618reverse transcriptase

Sequence
3631 bases(100 bases per row)
TCACACACATCTAAGCCTTCCTCCGATCTACGGGCTCCCCGTAGATCTAtcatccagctccttcaccaagGTGACCATTTCACCTTGGTGGTCCGATCTC
ACTCCTCCTCGTGAGACTGCATCGCGCCAAACCGGTTTCGATTCGGACGATCTCGATGGTACTCGTGTAGCAGCGCTCCACAGTTGAGGTCGACTTCGTC
TACCCAGCTGAGATCGTCGTAGCCCTTCCAGTGCACAAGGAACTCTCGATAAGTTCGGCCGTACCGCGCCCGTCTACCAGTTTTCATGTCAgtgatcttc
tccacttcgtattCGTTCGCACTCAGATCTGGGACCCAGCTGTCCTCAGGCAGCAAAGTCTCGTCGAAATCCAGCCGATCGGCTTCGTCCACGGTCAACT
CGATCTGCGGCCGGTCCGGGAATTCACTAACCGTCTTTAACTTTGACACGCGAACAGATGATATTTGGTCCCATCGGTCTGAAGTCGCATGGTGTACTCG
TTGGTCTTTTCCGCAACGTGAAATGAACCATGCCAGAGATGGGCTAGCTTCCGGGCGCAGCCTTCCTCCACTCAATCTAGATATAGCCACACGTGAGATC
CAGCTCCGATCGAGTGCGGTTGAACTCCTTCGTTGTGCCGATGGGCTCGATCCGAGTTCGCATCTCGAAGTCAGTCATTAACATGTTCTCGGGCCTGCGT
AAAGTGTCGTTGGATCCGATATTGCCACCTCTGAGGATCGCGATCCTGCGTTCGGATGCATCCCAGTGGTATAGTCGCCTCGAGTGTCGATCGCGGATCC
CATCCATGTACCAGATAGAAGGGTGTATCTCCACGAACCCGATCTTGAGCTGTGTTGGTCGCGAATGTTAGTCGCTCCGCATACTTATCCCAATCTCGTT
GATCTAAGTCCTGAACGAACATCTTCAaagctctcgtcgtcgtctgtaCCATAAATTCTGCTGTGCCGTTCGCCTGAGATCGGTACGCCATCATGGCCCG
CTGACACTGCCTGATGATCTTGTTAAACGCGTGGAAGAAGTCCGACATGAATCCGGGTTCCCGATTGTGTCGAATTGCCTCACTTGCTCTAAATCTCCGG
AAAACACACTCTTCATAGGATTCGGCGATCGTTTGCGCTGTCCGGGATGCGCTAGCTTTGGCGATCACGTACCCCGTGAACAGATGGAcccagatcagca
gctccgtgtaTCCTTTGTACGACTTAGGTAGTGACAGTATGTGATCCATCGCTATGATCTGGAACGGGTACGTAGCTTGGATGTTTCCAGGCGATTCGCC
CCTGATCGTTGGTCGTTGCTTGCCAGTTTCACAGTCAACACATCCGCCGACATACTTCTGCACGCTATGATATAGACCCCTCCAGTGGAAGTGATCCCGG
ATCCGCTGATAGGTACGGCCGATCCCTTGATGAGTTCCTTCCAGACTGGTGTGGTAATGGTGCAGGATGTCTTGGTGTAGCGTTTCTGGTGCAACCAACC
TCATCAATCCGTCTCGATCGGCTTCAGATCTCTTGGTAGGAGGCAGTAGAACAACAGATCCTGGCTATCCACTTCATAATCAGCCGCATTATTGCCGAGA
GATCTAGCTTCGTCTTGCATCAGATTCACCACGTCTCCTGCCAAGTACTTCTTCATACTCGAGATCCACGCTTCCTCACCCTGTGCCTTTCCGATCCGAT
CAATCCGCAGCCCACGGACAAACTTTTCTTGCATGACCGTTGGGTTCGATCTAGATCGAGTACCGGACCGAGTAGCCACTGGCGAGATCCGGGCGACTGG
ATCACTGGATCCGACTACCATAATTTCGTCGAGTCGATTCAACGTGATCAAGTCTTGACGATCTGCTTCACTCTCAACGTCAAGCCCTCCCTGATGTTGG
AGAGCTGCGCTCGCCAGGCTATCCGCGCTACCATTCCAGTCACGTTTAACATGTAGTAGCTCGTGGTCTGGCCAGATCCGCAGCAGATCTATAGCCTTCT
GCTTTAATAACGTCAGTCCGGGTGCCTTGCAGTCGATCTCTCCTCTCACTTGCCGAATCACTAGATTAGAGTCGCCACAGATTACTAGGCGCCCCGGATC
CAGGCCTTCCAGCAGTTCAAAACATAGCAGTAAGCCATGATACTCCGCTTCATTGACTGTAAGACCTTTGACGTAGCCCGACCTGGTCTTCACCACACTC
CACTCAGGTAATTTCCATAGGATCGCTCCGAACGCACCTCCTACCCGTTTAGCGCGGGCGTATCCATCGAAgctcaccaccaacagcTCTTCATCAGCCT
TCACTGCCTGGACCGGCGTATGGATCTAACATCGAGGCTCCTTTTTCGGTGCGGTCGCGATCAAGGCCTCGTCGACCTTGGATCTAGGTGTAATACTGGC
GGCGATCGCCCCCAAAATCTCGTCTTCTCCTTTCGAGCACTTCACGATCGCGAGGGTCCAAGGTGACAGGAGAGCTGCCCACTGACCTAGTCGGCCCTGG
AGGCCCGGCGATCTGAATAGCCATACCAGAGTTGAGTGCCGAGTAAGCACCTGGATCTGGCGCCCAACTAGCATATTCTAGTTGAGATCCAGGATCCACA
GCAACACTagcacttccttctccaccacattGTTGTTCAAATCGTTTGATTTGAGCGTCCGACTGGCGAAGGTGACAGGACAGTAGATCCGATCGAGTTC
TTGCACCAGAGCAGCTGAGATCGCCCAGTCACTGGCATACACGATCACCACTGGTAGTCGATCTGGACCGAAGTGATGCAGAGTCGGTGTCGTCgcaacc
ttcttcttcaacattGTGAAAGCCTTGTGAGCTCGGAACCACCATTCGTCCGCGACGTCGAGGTCTGGTTGACCTGgatccagcgcctccagTCCTGACG
ATGCTGGATCGGGTGGCTCCTGATCTAAACTCTGACCCAGATCAGGACGTGCTATCATTTCGGCGAAGTCCACCTCCCGCAACTCGTATAGGATCGCCGC
GTAAATCGCGTAGTCTTCTATGAAGCGGCCGTAATAATTTAAGCTGACCAGAAAAGACTGCATCGATCTGAGTGATCCTGGGAAAGGCAGGTCCGTTAAT
ACCGACAGATCCTTAGGGTTCGCCTCCAGACCTTCACTTGACACTCGATGTCCTAGATATTCCACCTTGCATAACCCCCATAATCTCTTCACCACGCTGA
TCGACAAGTTCCACTCAACGCACGCTTCCAGTAGATCTTCCACCCGATTTCGTAGCTGATCCCAGGATCCGACTGTCACTGGGGTGTCGTCGATGTAGGA
TCTGCGTCCTAACACTGATGGGCGTCCTGGATCCTCCGGTTCCCCAGCCTCAAACAGATCCACGATACCTTTAGAATTCTCTAATCGCGGGATCCGCATA
ATTCCATACAGTGCGATATCCAGGAGCCGTTGATAGATCTGGGGTGAGTTTTTGAGGGTGAAGGGCATCCGATTCCACTCGAACATGCCGAACGGAGTAA
TGAAAGCCGAGATCGCAAGAGCTCGGTCAGTCATCGGCACCACCCAAAAATCACTCGCCATATCCAGAGAGCAGTACCACAAATACCTTGTCTAGATCCT
CGAGTAGATCGTTGATCAGTGGCATCAGGTA