Description :
From Genome Similarity Track
Location :
contig_120:33621- 37459
Transcript NameFunction/comments
g11370.t1hypothetical protein PHYSODRAFT_261658

Sequence
3838 bases(100 bases per row)
ATGATCGTGGACAAGGGAGGTGGCCCACCTCCAGTAAATTACTGGTTGTAATTCAGGTGGAAGGGGCACCATGGATTGGTCAAAATTATATTGTCTGGTG
CTGGTCTCAGGGCTATAGTGCAGGTCGCCATATTGCGGTGTTGTCACCCCAATATCGGGTGGCTATTAGGTATCGGTCGGTGCCAGCTGGTTTTCAAGGG
TGCGGGTGGTACACTTTTGGTGTTTTGTGGACAAAGTTTGGTGTAAACAGTACTCCCTCCATGTACAACTCGTTCGGGACGAATTGCTGCACGTAGGAGG
AGGATGCGCCGGACAGCCAGCGCTCCGTCTCCGTTGACGGGTGGTGGGCAGGGTTTGGTAGTAGACCGCAGAGTAGTAGCGATAGTAGTGATATTATCAC
TACTAATAGTACTACTACTACTATAGCAGTCGTGTTTGGGCCACTAGTAGTGCTAGTTGACTAGTAGCGGAAAATAAGGCCACTAGTAGTGCTAATAGCA
CTACTAGTATTTTCAAACTTCAAGTTGCCCAAGATCTTGAAAGGACATGGCTCTCCGCCTCTCCCTCCTTCGCGCTTCTTTTGGGGTCGCTTATTTCTCG
ATTCCCCACCCTGTAACACACACAATGAGGTGCGCGAAGCTTGACTGCTGTTGGGAAGACTTGTCGGAGACATCTCCTTGCAGCGTGTGCGGGCGTATGG
TGCACCACTTGTGCAGCAATGAACTCTGCACAAAAGCAGAGCTATCTAAAAGGTGGTAATGCTGTTCGTGACCCCATCTTGTCTCTGTTGTTTGTACTAA
TAAGCTCTACCTGCAGATTCTGCAGTAGTGCCTGTGTCGCCAAGTTCTTCAGCAGTGACAGCGACTCCCAGGAGCTGACACCAAGCAGCACCTCTGGCAT
ATCACAGTCGAGTACAGCCACGGTGATAGATCTCGCACAACGCGGGGAAAAGCAGGAGCAGGAGCAAGAAGCCACTGACAGGATCCCGGATCACATCGCC
CACGCCCCCCCAATGAATTCGACCGACCCGATTTGGGACTTGATTCATCAACTCGACGAGGCATTCACGTACAGGGGCAAGAAGTTCACACACATTTGTC
TGCTGTGCACGGAGTCGAAGACCTGGAAAGACTCTCTTTGTCGAGCCAGCAACTCTACAAACGCGAAGACGCACCTGGTGGCCAGTCACAAAGATCACGA
GATGGCTATCCAAGAGCAGCAACGTAGACTAAAACGGGCCGATCATTACATGGTGCAGGTAAACACTAGAAAGAATGTGAAGCGCCTGGCCTCGAGTGTA
CGAAATTCACAGGAAGAACAGCCTATAAAGCGTCAAAAAACCTGGTGGAAGGCTTCAGTAATCCAAGAGCAGATCTCAGGCCACATCGCGCGGTGGCTGA
TCCGTGATGGTGCGTGTTTCGGTTGCTTCATTCCTACAAAGTCTTACTCAATTTCTTTACTTTGCCAGGATTGCCGCACAACATCGTGACGACTCCAGCC
TTTCGCGATTTCCTCGTCGGGGTAACTGGGACCCGAACGTCACCGTACCAGCCGCCAAGACGTACAACGAGATACTTGACAATCACTACGACAAGTTCGC
GAACGACACCTCTGAGTTTTTGTTGAGGAGTTCAAAGAGCTGGATGAAACTCCATTCATGACAGTGGAGCACGACTTGTGGACAAATAGCTGTAAGAATA
GCATTGTTGGCGCTTCCTGCAGCTTTATCGACCATGAATGGCATCCTCGGCGACTCGCCCTTCTCGCGGAGGTAAAAAACGACGGACACAGTTCTGAAGA
GGTAGCAGATTTGTTAGACGAGCAATTGAAGGCCCGCTATGGTTTGGATGTTTCGCAAAATGGCCAGCTTCACAATTTCGGACACGGCGGCAGCAGCACG
AAAGGTCTCAAGGCAGTTCGACTCAACTTTGCAGACCGATTGCGCGATGCACGCACTTAACCTCTGCATCAGCTACGGTATTGGTCTGAAGGAAAACGTG
CGCAACGAGTATATGAAAGACGAAAGGACAAAGCTCTTCGTCAAGAAGCGCGTAGTCGTGACCCAGGGTGGGGCATTCCCGGAGGGAGGTGCAGTTATTC
GAAAGCTGCGCAATCTCAACAACTTCTTCGCGTCGATTAAATCACCGGAGCGTATTGCTCGTCTCCGTGACGTCCAAAAATTTCACAAGCTGCCTCAGTT
AGCAGCTCTGATTGACATCGACGTCCGAGTTGCTTCAACAATCAAGTTATTCCGGCGCTCAATTATTAACTATCCTGCATTCCAGGCGTTCTTTCAGAAC
GCGAACGTACCAAAGAGCCAGAAGAACGTCTTTACCTGTATTACATGTGCTGAGTGGAGTTAGTGGTTCAAATGGAGGCAGTGATGCAACGTATAGCGGA
ACTAGCTCTAGTGGAGTCTCAATCGGCAACCATGCTGTCATCTACTATGTACGTGCTGCTGCGCGTGGCCTCTGCCCGTATGAATTCGTTCAAGTTCTCT
TCCTACTGTTTAAACGGCGCTCGCGACACCGATACCAATGAGACGAACTTCCCGAGAGCTCCAGTGACGTTGCCCGATTTATCACAGTTAACCCAACGCT
GTATTAAGCGCACGCTACATCAGATTGCCGAGCGACTACCACTGCCGTCTGTGCCGATGGGCATGGCTTTGCTTCTTGACCCACGGACAAAGACGGCTGC
CAAAAACTATCTACGCATTCCGGATACCTCGGAAACAGCTACCGAATATATTTTGGAGGAGACGAAGGCACTTTTGCGCATTGAGCACCGCGTGTTCTAT
AAAGGGCTGCATGCAAACGCTGATCAAGGAGAAGGTCACGTAACTTCTGCCTCGAGTTCACCACGGGGAGAGTGCAACAGTAGTTCCGACGCCGAGGCCG
ACTTAGTGTATGGGGAGGAGGTCTCCCAGCCGGCCGAGGAGAGCACTGCTGACGCAACCCTGAACGCGAAGGCTGATGCACTATTGGGCGAATGGCTCAG
TCTTCGAGTGGAGTGGGCTGAGGTGGTGAAAAAACAGTATCCAAGCAAGGACGAGTTCGATAAGGTGCTAGCCAGGCTGAGCGTGCGCGACAGAAAGAGA
AACGTTCGGGTGTGGAACGTAGAGCAGCTATGTGGACATGTTGACGTGTGCCGTTGGTTTGCAGAGGTCGGCGAGGAAATGTATCCCTCGATTGCGAAAC
TTGCACGCGTCTGGCTGGGACGAGGTTGCTCGACAGCGTTTCAAGAACGCGTGTTCTCAACCGGCTCATTTGTGATGAGCTCTTTGCGCACACGGACGGA
CAATGAGCGAGCTCAGCGACAGCTGATACTGCGTCATAATCGGCGTGAGCTAAGGCGCATGGAGGAAAGCAAGCGTCAGATATGGTGACGCAGATTTTGC
CCAAATAGTAGTGCTATATCACTACTATAGTATTATTACTACTCGCGAAAATGCTCAACTAGTAGCTAGTAATAGTAGACCTGATTCTCAAGACTCGAAT
AGTTAGTAGTATCACTACTAGCCGAAATTCCCACTACTACCAAACCCTGGTGGTGGGAGGCCCGTATCACCGCTGCCGCGCATCCTTCAGTGATATTAGC
CTGCGAGGCGGCAAGCCCATCGCCGCCGCTGCACATTGCGGACGCTGAAACCAGCACTGCTCCAGCAAACAGCTTGAGGGTAAGGGCGTCTTCAACATGC
CTCGGCGCCGTTTAGCAGCTCGCCGCTGGATTTGTCCAGCGACGATGCCGTGGTCTGTCTGCACGCAGCTCCATATCGGTACATGTACATGTATTGTACT
GGCCAAAATAGTTGATACCAGGAATTGTAACACGAGCA