Description :
From Genome Similarity Track
Location :
Scaffold_399:3362- 6900
Sequence
3538 bases(100 bases per row)
TCCAGATCCAACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCAGATCCTCATTCACCTGTACCGTCGGGATCGGGATCTAGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCC
TAGTCAGCGCCTCATCCATCTTAGCCCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTTCAGTGT
CCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGCAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATG
GGTCTTCCCACTAGCAGGTTGTGATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTTATTCGGCTTCAGTG
TCCAGCTGACGAAGGTGACTGGATAGCAGATCCCCTCATGTAATTGAACCCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTT
GACGTTCCGGATCGAAGTGACGGAGGATAGGCGTGGTCGCGATTCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTG
TTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGATCCTCTCTCTGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTA
CCACTTGGATCCCTTCGTGGATCCGGCATCTCCTGGGCCAGAGCTTGTTGGATTTTCATCTGGACAGCTGGAGTGGTCATCGCGGCAAAATCTACCTCTC
TCAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCCGTAACGACTG
TGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTACTCCACCTTGCGCATCCCT
CAATAGCTCTTTACCACACTAATAGAGAGATTCCACTTAGTATACGCCTCCAGTAAGGACGTCACTCTCTCGCACAGCTGATCCCACGATTCCGCCGGGA
TCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGATTGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTC
CCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAAC
GGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGT
CTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCG
GTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGACTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGC
AGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAGCTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCAC
ATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTTTTAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGG
TTCATTCGCCCCCGGATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCG
GCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGTTCATCTTTCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTCTCGCCTGGCA
GTCCTTCTATCTTCGGGGGTTTCAGGTAACCTGGTTATCAGGGAAACCACCCAGTTGGAATTCAGTTTGGTTCTCTAAACGAGTTTTAGGCCCAAACAGT
TTCGGGTTTGACTGGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCG
GCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCCTGGATCCAACTTCCATTGCTTGGA
TCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCGAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGC
GAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGAATACCG
TCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTT
GGATTACGGTAGGTACCCATTTCTCGCCCCGGGTGACTCACAGTCTTTCATGTTCCACCCACTTTAGCCGGTCTGGCAGCTCCCAAGTTTCCCCGGGCTC
GATCCAGGTGGTCTTATCCGCCCTTATGATCATCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAGAGT
GTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN