Description :
From Genome Similarity Track
Location :
Scaffold_1:33606- 44599
Transcript NameFunction/comments
Phyta_totarag10hypothetical protein PHYSODRAFT_264096
Phyta_totarag11hypothetical protein
Phyta_totarag12protein kinase, putative
Phyta_totarag13hypothetical protein
Phyta_totarag14protein kinase, putative
Phyta_totarag15conserved hypothetical protein

Sequence
10993 bases(100 bases per row)
GAACGATCCCGCCACGTACAAGCGCAGCCAGGACCCAAATTGGAAGAACACGGGGCTGGACGACATCTACTCCATGTGGGACAAGCTCGTGCCCGTGGAC
GAGTTGCCCAAATATGAAGAAATGGGTCAATTCCTGGTGGACCACGACCCCCAAACGGCTCGTGAGCTAGAGAAGGTTTTCGTGCTACTCCGACGCAAAT
TCAAGTGTTTGCCAAAGAAGTCCCAGATGAAATTCGTGTTGGGACTATTGGTGCAAAAGGGTGCAGCGCCGAGTGGCTTGGCACTGGAGAAActgctggt
caagaaggcgcagaAGAGTCAGTCGGGTGTGTTGGTCGTCACGGTGCTCACAAGTCCGTACCCGACTGTGGGCGGCAAGAAACAGCGGTTCAGCTGTCAG
TGGAACTGCTACTACTGTCCGAATGAACCGGACCAGCCGAGAAGCTACCTGCACGACGAACCGAGTGTGCTGCGTGCCAACCGGAACGACTTTGACCCGG
TGTTGCAGTTTTGTGACCGGTGTGTCACGTTGGCGATGAATGGCCATCCGGTTGATAAGATCGAGTTGTTGGTGCTAGGAGGAACGTGGGCGTCGTATCC
CGTGGAGTATCAGGAGAACTTCATTCGCGACTTGTTCTATGCGGCGAATACGTTCTTTGATAAAGAGAAGCGTGAACGTCTCAGTCTGGACGAAGAGAAA
CTGGTGAATGAAACTGCGGCAGTGAAGATTATCGGTATCACTTTGGAAACGCGACCGGATTGTATCACACCGGAAGAACTGCGTCGATTCCGTCGCTATG
GCTGCACGCGTGTCCAGCTGGGTATCCAGCACACGGACGATGCTatcttgaagaagatcaaTCGCGgctgcactgctgctgactcgGTGCGtgcgctcaa
gctgctgcgtgactGCTGTTACAAGACCGACATCCATCTGATGCCGAATCTACCTGGAAGTGACCCGGTAAAGGACCGAGCCATGTTCGAGTACGTGCTG
CACTCGCCGGACTTACAGGCGGACCAGTGGAAGATTTACCCGTGTGAGATCACCCCGTGGACTGTGATCAAAAAGTGGTACGATGAAGGCAGCTACGTGC
CTTACGCGGATGATAAGCTCATTGAGCTGCTGATCGATGTGAAAGCCGAAGTGCACCCGTGGATTCGTCTCAACCGTGTGATCCGCGATATTCCGAGCCA
GTACATTTTGGGTGGAATGGATGAACCGAATTTGCGCCAGGTGATCGGCAACAAAATGAGCGCACGAGGTACGCCGTGCAAGTGCATTCGGTGTCGTGAG
GTGAAGACTGACGACGCCGCTATTGCCTCTGCTGAGTGCGTTATTCGGGAGTACGAGGCCAACGAGGGTGACGAGTACTTCATCAGCTTCGAGACCCCGG
ACCGCTCCAAGATTTGTGGATTTGCCCGATTGCGACTCTCGCAGaccgctggtggtggcgtgtTCCCAGAACTCGAAGGTGCCGCATTGATCCGAGAGCT
GCACGTGTACGGACAACTTGTGGCCGCAatcagcaagtcgaagaaggaTGCAACCAGTGCCTCTgcgagcgacgcagcaggcTCTCATGCGCAGCACACG
GGCTTCGGTACGCAGCTGATGatgaaggcggaggagatTGCTCGCGCCCACGGATACAAGAAGATGGTTGTGATTGCAGGTGTGGGTGTTCGCAATTTCT
ATCGGCGGTTGGGTTTTGAAGtggaaggtgaaggtgaGCTGATGATCAAACACTTGGATGAACTGCCAGCGTCAAGTGTTTGGTCGAAGGTGAACTCGTT
CCTTTCCGAAAGTCTAGGTCAGGATTTGTCGACCCGCCAGTTGAGTGCGGTTGCTATCGCTGGTGCTATTGCCCTTAGTGCAGTGACTGCAGTAGTGATC
CGGAGAAGATAAAGTTGTACTGGATAACTTGATCTACTTTACGACGGATCTATAGTAGCTCTAACAGCGCGTCTGGAGTAAATACAGCTCAAGTGATATA
ATGTGCTCTTGCAATTTGTAGCATCAAGAATGGGAGTGCGCCGTTGTTTATCATGTTTGAACCAGTGACCTTTGCATTTGTGTGATATGCAAAAAAAAGA
AGCTAAAATACCCCAAAGCTCGTATGGAAAAAATGAAGTAATTGAAGATTTCTTGTTCTGCTGTAGTAATGACAGCATGAGTCACTGCGCAGCCCTTCTC
AAGCATCTAACAGGAGACTTCCACCGACTAACCAATGTGGACAAGAGTTGAGACCTTCTGTACGATCTTCACAACAATCTCGGGGATGCTTTTTGCTATC
TCGTGGAACGATTCCGTTTTTGAGACCTTTTCAAGATTGTGAAGCGTGAAGGAGAAACACTTGTCACGTAGCAAGGAGTGATTGTGCTGGGTAGCAGCGA
GCAAAATGCCTGCAGCGTTGTCGACGCACAATGACTCGAGCAACTTTTTCGAACAAAGTCGCTTGAGACTTTCAATGCCGTACTTGTTATCAGACAGTGA
CAGATTAGCATCAGTACTTTAGTACTAAGTACCGTTGAATAGATCAATCAACTGCGAAAGACGTACCCGGTTAGCGACAATAAACAGCTCCTTCACACCA
TCGCCCGAGACATTCAGGCGATCAGTGTACACATACTCGAGCAAGGACAGGAACGTCGAACGACTTACATCAGATTTCTACTCAGAAAACATTGTTTTCT
GGGATCTACGGCACACCAGATCGTAGCATTCATCATCCGCACCAATTCTTTGAGGTAAATACGCACAGATTTCGTGTGTTTTTATACATACCTTTCCAGA
AAACATAGTCTTGAAGTAGTTGCAGCGCACGCAAATGCACTTGTGAGCGAAAAGATCCGTTCCTTCGACTGATAAAAAAACACAACAGACATTGTAAGTG
CTATGAAGTTATCTGTGTTTGGACAACTTCGTGGAGAGTACTGAACTTACCAAAGAAAGTCACGTCGCTCATCAGCTCATTGTTGACCAACGAGCGCAAG
TGGGCAGCCATCGTTCCCTCTTCTCCATTGAGCATCAGTTCTTTCTGGCCATCAATCCCCATCTCTTCCATAACTTTCGTCCTCATTTCTTGAACATGGG
TCCTCGTTTCTTTCTGGTCATGAAGAGTATCCCCCCAAATTTCGATAACTGCTCCTTCATCCTCGATAGTATCTAACGTTGAATCTTCAGAGTCAGGAGC
AGGTGCATGAGCTGTAAGAGCAtcaacagcaccaccagtTCCCGCACTTCCATCACTTCCATGTCTCTCATAATCGCTATCAGAGAGGTAAAACCCGTTC
TCGGTATCTGCAAGTACAGATCCACTGTCAACAACGTCAGTTGCAGCTGTAGAGGAATCGCTGCTCCTAGTTTTTGCAGCACTCTCCGTTGcaccatcat
ctccaacgttttggcgcttgagcttccGCTCACTGGAACTGGGTGGATTCCGCTTGGCTCCAGCGTTGGCACCTGCCTTCTCGACCTCACTCTCCTTGTC
AGTTCTTCTCCTCTCATGGCTGGCAATTGCGGGTGGTCTCGCACCTCCAGACAACCGTCGGAGTTTCCGCTCGACTTGCTCAAGTGTGGTAGTGAAAGTC
CACCCCTTTTCCTTGACTGCATGGTTGAATAGCACCGTCTTCACTTCATAGGGCTCGTCTTTCGTATTATTATCGATGGCCAACAGAAGCTCCGTTCGCT
TCGGGTTCCAGTTTATAGAGCGAGACTTGGCAGGTTCATGACACGGAACAATTTTGCACACCTCCTTGAAGTGAGTTTGTATCTCCGTCATGGTAAACGC
GGGCTCGGGCACTAGCACGAAGTCTCTCCTCTTATACAGCTCGTTGGTGAACTCTTGCATTCTCTGCGGCCAAGTGTCGAAGCGTCCAGCAACGCTAAGT
AAGAGCTCTTGCTGTTCTTCCGTCCATCGTGACGAGGCCATGCTGCACTTCAAAGTGAAAGAGTGAAATTTTCGATTTTGGCCACTGTAATGATTCACTA
CAATGCATAAAAAAATCGAATGGGATAATCGCTTTCCATTTATTATACACAGTGCAGAGTTGCCAGGCCTTGGAacagcagaaccagcaaTGGCTTTAGA
GGCAGGCTCAGTTTGGCTGCACAAGAAAAGAAAGTCTTCTGCATGTCATATACTTGAAATTTATACCTCGGTGCGATAACAATAACCACGTGTGTTTGCC
ATCCATGACGTGCCGATCGACCAAATTACAGCCTTTCGCTCTGTTCCATGCTTTGCCTCACGAACAGTTTGCCCACACTTCGAGGTTTCACAAAAAAAGC
TTTTGCAGAGTTTTTTAAAGTGCCGAACAAGACTTGCTGTGGAGAAACAGTGCCGTTCCGCATCTCAGCTTTGCGAACACTTGCCACGGTAAGCTTAGCA
CCAGAACACTTGTATCTGTCATGACACGCTTTAGACAACCTAAATGTCAGCATCGAGGATTACTGCCATGCGAGTGTACTAACCATGTGCACGACGCGCT
TCCTTGCTGGAACGCTCCCGTTCCGTGCTTTCATCAAAAAGCCCTTTACTTCGGAGGTTGTCTTACTGACAGAATCTACCACGGCTCcggactacatgta
ctaaaAGTACGCATGCTCTGACGAGGACCAAACAGATTTCAAATCAATTCCATTCACGtgtcagcaacagcatcggACGGGAGGCTTCCACCGACTAACG
TCCTGGGACAGCCGAAACACTAACTGTAACTTTTACAAATCACCACTCACTGTTTCGATATGATAAGCCAACCACAGCTGCAAATAACGAGCTTGTGCTA
CACCATTCTTCGCCGATATCATCTGTAACTTTGGGCcgcttgttcttcttctgagACTCGGTCGTACTCTTACACTCCGCTTGGAACGACCGTTAGTGTC
CACCTCCTCGACCCCACTATCGTCATCTGCGGTTTGCCGCCCATAACTTGCCTTTGCAGGTAACTTTACGTCTTCAGCGTGTTCGTTTTTCTTGGACAGC
TGTTAACGTTTCATCTCGACTTGTTCAAGCGTAGCAGTGAATGTCCAACCCTTCTCCTTGACTGTATGGTTACACAGCACTGTCTTCACTTCGCAGCACT
CCCTTTTGTATTCTTATCGATGGCCACCAAAAGCTCGGTTCGAATAGCGCTCCAGTGAAGAGAGGGGACATCGCGGTTTCAAGCGGAGCATTTTGCAGAG
CACGGTGCGTCTCTTGTCAAATGCTCGTTAATAAATTCTTGCACCCTTTGTGGCTGAGTGCCAAAACACCCGGCAATCTTCAACAAAACTTTATCCAGCT
CCACATAGGCGACCGCATTGCTCTGGAAGCTGAAAAATCCAATGTGGGCTGCAAGTTGGAACAAGCTAAACGCTTGTGCGAGTAAACCAGTTGCTATACA
GCGTTTATGACACTGCCTTACTCGTTACACCCAAATGGATTGATCTTGCTCCTTGCGCAGGTTTGTCCGTGAAGCGACAGACTTAGCCATGGCAGTGGag
gttgcagcagcggcagtggctGTGGCAACAGCGGTTCTAGCTGCGATCGCAACTGATGCGCGCTGGCTCGAGACTAACGAGTCGTCCAACGCCGTGAGCA
CTTCTTGCATGGACGGACGTTCAGTGGGCGAGTCGTGGAAGCAGTTCTGCATAAGCGTCTGGAGCGATGCTGGGAGCTCCTTCGAAACGGGAAGTCGTTC
ACCGCGCAGGACGTGCATCATAGCCTCGACAGGAGTTAGCGACGCAAACGGAGGCGAGCTAGTGTAGGTCTCCCACATCAACACACCAAACATGTAGACG
TCCGAATCATACGAGAATGCGTGtggcggctgcagcgactcgggTGCCATGTACTTGACAGGCCCCACGGCGTCCTTCATAAGCATCCCGGCCGTCTCAG
ATCGTACGCGGCGACAAAGGCCGAAATCGCAGATGCGTACGCGATTACCTTGGTCCACGAGACAGTTGCGCGCAGCAAGGTCACGGTGAATGAAGCCACC
TTCGTGGATATTGAGCAgtccggcagcagcgtccttcAGCATTGCAGTGCGTTCGTCGACAGATAATGAAGAACTGCCGCGCAAGTTATCTTCCAGACTA
CCGTAAGGGAGATACTTTGTCACCAATGCTAGCGGGAACTTTGTGTCTGTGGATGCACCCACAAAGGGCACGATGCACGGGTGATGACCAAACATATTCA
ACATcgcagcttcgtgctggaacTCACGCACAATTTGGGAGGTAGTTTCACCGAACTCGCTAGCTCGAATGGTTTTCACCACCACATCCTGACCATCCAA
CGATGCGCGGTACGCGTCGCCAAAGTAACCTTGGCCTACaagctccttcatctccagcgaCCGGAACGGAATCTCGCGGTACGTCTGTTCCATCACATCC
ATCCAGCCCTCCAGCACATCAGCTTCTAACTCTCTTGGATCCACCGCACGCGAACCAACCAAGACAAACGCGTTCAACATAGCGACAGAAGAACCGACCG
TAATACGGGCCTTAAACAACACACGCCCAAACGCGGCGCCTTCCGTGCATACCACATCATAGTCAACGCTTGAGATATCTCCTTCCCAAGCAAAACCTTG
TGTTGCACCATTCAGCACCTCGAAACCATTTGGTACTTCAAGTGTCACGTGTACAAGAGCACCGCGACGAACATTTAGCTTGGTTTCTAGCGAGAGCTTT
CGCGACTCGGGATGGTCGCTCTTGGCTAGCTCATGCATTTCGGACCGCTGATTCAATAAAAAAGCCCAGACCGTGAATTGGAACGGTTTTGGCGACGGGC
TGACGCTCGGTGGGGCAAACGCACTGAAATTCACGCGATCTCGACGACCAGGCCCTCCTTTAAATTCTAATACCGCATCTAACCCACCTTCCTCCGTCGC
CATTATTGATGCAGAGCGGCGAGGCTCAGGTACAGCAGCCATTTGGATAGAACGGTACACCTGCTGGAACTTGTCAGTTGAAAATTCTGCATCATGGATG
CTATTTGTCGGAGACAACACGTCGTAGGCATGAGCATCCCCAAACGAGTCACGGCCCGTGCCACTGCTTCTGGGGGAGTTCATTGGCGAAAAACTATCGT
AATCTGGTTGTTCCGACGGACCGCGATAGATTGGACTCGGGTCCAGAGCAGTGATGTACTGAGGAGGACTTTCAGTATAGCTGAGTGGTGCATATGCTCG
CATATTTGTcacgtcgtcatcttcataGGAACGTGCAATGTTTCCATATCGCCCTAGGATCTCAAGATCGCTGATGTCGTGTGCAGAGCCAGCCTGGGAT
ACATGCGCGATACTTACTGATCGTTTATCCTCTTGTTTTTTATTATGCTCCACTCTGTCTGGTTGATCAAAAGcattgctggtggtgcgcaATTGGTGAT
CTGACAGAGTACTGGGTCTGCCCCGAATACGAGACGATAACACCCGCTTTCGAGGGTCTCCAGTGGACGTCATGAAAGGTGTACGCCTTGCGTAAGCTGA
TGCAACGGGTGGCactggcggtgctgcaggagctgatgaaggtggtagtgctggagaagcagttgGAATCGGGGGTGCAGTTGGTGTCGGGTGGCAAGGA
GCATCTTCCGACGACTGCAATCGCTTCCGACTCGTTCCTTGCTTGGTTCCCGGTGCGCGAAACGCTTCGTCAGCTGCTTGTTCAATTTCTCTTGCGTATC
TATCACGTTCTCTTGCCTCAATATACCTCTCCTGGAgatcagcatcttcttcacgtagTTTACCCCTCTTTTCTTGAGCTATGAGAAGCTTCTGTTCGTA
TTTTTGCATTTTCCTTTCATAGCGCCTCTGTTTCCACTCGGCATGCTTTTGGCGAAAATTTCCAGCTTTTGGCCCTGTCGAACCATCCAACGCAGCTTGT
TTCCATTTAGCTTCACCAGCCACTTCACCTTCAGCGTGTCCAATGTCTCTGGATGAACTACCTGCGCGTTTGAAATCTTGTCGAAACGACCCCTGCATTT
CACTCAAGCGGTGGTGGACGTTATGGCGGTCACGTAACAGGTTACGCACAGCACCATCTTCGTCACTTTTATTCGTGTCTGGCCATTCCATCGTGTGaag
atcgtcgtcgtcttcctctgaaTCAAAATCATCTCGCGCTTTTTTTCTATGCCAGTACTGCTGGAGAGAACGGCGACCAACAGGTTCGGACAAGCTCTTA
TGCATCAAATCATGGCGATGATGATCATGGTTTCCTGGGTCGAGCGTGTCCGGTACAGTAGCCCGCTCCCAATGTGCATCATAACTCCCCCAGCGTGGGC
GATGGGAGGGAAGAGGCGGCGCAGACGGCGTTAAGTCCAGTGCCTCATACATACTTTTGTGCGCTGGTTCCTTCTTGAAGCTATCGTCTTCGGCGTCGGA
TACAGTTGCTGCTACGGGAACGGCGACAGCATACACGTCATCGAAACTGTTTCGCCGACGCATTCCTCGTCGACCTTTACCGCATCTCCTCTGGTCCATA
TGAGGCCATTGCCAATCGTGCCAACCTGACCAGTGTTGAAGCCATCGCTCGCGCCAATCAGCAGCCCATGGAGGGAAGTCACTATTGAACGGGGGGAATG
GTGGTGGTCCGCGTACATCGGGCCTCATTTGATCGAGACGCAAACCGCCTCGGCCTCCACCACGACCCCATCCTAGCCCTACCCGGCCAGTGCTATCGCC
CctaccgccaccaccacgcctGCGCCCACCACGACGGTCGCTTCCACTACCTCCGTGTTgactgttgctgctatctTCACTTCCGGTGCTAACCTTAACA
TCAGACTTGATAACAACCTTGCAGCAACACATCTCAAGCTCCCGGTCGTGGTCATGATTATGGATATCGTTTTGAAACGCGCGTTCCACGTGAGGTAATT
CTCGCGATGGCGGCATCGGCGGCATTGCTGGATGCATCCTGGATGGCACGAACGGGGACTCCGAGCCGTCAAAACTCGCCGGTTGCTGCTTCATACCTTT
TGGTCCCATTCTAGGGCGTATTACGTTCGATTCGCTAGCGCTGCGTCCTTCCTGATACAAATTCCGAGTCACAGCTTCAGCGGACGGCTTCTGGGTAGAC
GCAGACGCACTATCACCTCTCTGTCGCGAACGCGGGTGCTTTCCACCCATTGTTCCATAATTACTTGAAATACCAGCTCCGTCCGTAGTAATATGCCTCT
GATCCTGTCCACGTCTACCACCCGCCTGCGTCGCAATGGGCAATCGATCTGCCTGCTGTTCTCTCGTATCTTCGCTCTCACTCCTCAAAAATAACACTTC
CGACACGTTTCTCGACACAAACACCAATCCCCGTGCTGACGTCACACCCAATTGATgcgccaagaaggcgaacgCCAACGCCGTAAACACCTGAGTAGCT
GTCGTCCCCGTCGACACAATATTCACATCCGAGAGCCCTGCCTCCTTCGGCAGCACTTGAGCGACGCTCACTATCCACAATATCAAGGGCACTGCACTGA
AGATCAAGTCCAGGATCCATTTAAACACCAGGAAGTagagcagcgacagcaacatcaccGGAAACGTGACTTCCCCCAACACTGGCccctgttcctgctg
ctgtgactCTGGAGCGTcatcagcagctcgttgacCTCTAACACTCGATCTCCCTCGTCTTAATACAGGCCCTagctcgtcttcatccactACGAGCGCG
TCGATGGACATCTCCGTCCGCCACAGGATCCGCGTGAGTTTCCGAGCGAATTGTGACGATCCGACGAGCAGACAGCCcaccaggagcagcagcagcgacc
caGAGACAGCAAAGAAGGTCGCTAGCACGCAGGCGAAAGCGAAGGTGGCCACGTGGAAGCTCAGCGTGCGCACGACGGAGGCCACAACGCCTCTCCGGAC
TGGCATGACCCGCGACCTCGTACGGACCACAGTGGCGCAGGGAGGAcggtaaaaaaaaacgcgcGGTGAGAGCGAGGAGCGATACGATACGACGGATAAG
ACGACGCCCTGAAGACCTCGCGGCGGGCACTGGGGGCTGATGGAGAGTAGCGCTGGGGACGACGAGCTAGCTCACCCGCTTCCTTTCGAATTTGTTGCGA
GTGGTAGCTAAAGGAAGAGACGGATACAATTATCAAGAGTATGGGAAAATCGATACCTGCGGAAGTAGCTGCATGATACAGTCAGTCTTCGTTCGAATAG
CTAAGTAAtgtactacagtagtgaAAGGAATGGATGTGAGAGTTTATAATTTTGAAACCATCATTCCTGGTGAGGTGGTGCACATCAGATTTGAAGCACT
CCACACAGTAACTTTGAAATTCGACTTGTATTGCTTTATCGTTCGAAGATGCAACGCAAACTGCAACGCGGTTGCACATGGATGAGAGGTGGTGATGCCC
CCCACGCCTCTTGCCTCGCTCGGCTCGGAAGCATCGACTGTCCTTCCCAGCATAAATAATGATCTTGGGCTGGCGAGGGAGCACCACATCAAATGGATAA
CTTACGGCAATGGGTAGACGTTGGGTGAAGGAGCGCACGGCGCGAGCCACCTAAACCTTGCAGCAAATGAGAGCGGACCTAGTCAGTCCAGTTCGTGCAC
CAGATCCTCCACCTTGCGGTCCTGCAGCACTGTGAGACTCTCAGCCACCTGGAAGTACACGTGCACGTGAAAAATGTCGATGGACCGCTCCGGGTTGTCA
TCATAGTTCCACCGCTCCACATGCGGCGCGTTGGCGTCGATCCAGTTCTCCACGTACTGCTTCACCTGTTCATGGTTCAGGTCCTTGACATGCCACAGCG
TCCAGTGCTCGATGCCTGCAGGAGTCTCATACGGAAACATATTGGGTTCCAGGAACGCAGTCCTACCCTTCAGAGTCGTAGCAAATATATGTTCCTCAGC
AGACCCATAGTTCTCGGTGATCTCGTCAAGATGATCCCACTTGCGCTCCTTGCATTCGTCGGTCCGGCTCCAGTACTCGATGTAGAGCGTGCG