Description :
From Genome Similarity Track
Location :
Scaffold_8:336042- 337644
Sequence
1602 bases(100 bases per row)
CAAGATGTCGAGCTCCAGGCTTGTCATCTTGGTTCTTGCAGTGAGAATGAACCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACG
TGGAACTGCATTACCAGTAGGGCGCCCTGCGCCTACTGGCGTCCAGCGTTTTTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTTCT
GGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTAACCGACTCTACCACAACGGTAGCATCGCACATTGTTACCCTGCGACTGCTGGGGTCCAGCAGTTGC
AGCACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTACCGGGCGTGGTTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTA
AATTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGA
ACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTG
CTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACGCGTTTTGCGGGGGCTCAAACGCTTGTCTGAGCTCCTCCTTGAAACTCTCGTACGTGCTAAAGCAT
GTAGGATCCGAGAGTCGGCGTCCACACGCTCAACTTCTCGCTCGTCCGCCAAGGCATGACATAGCGAACGCAACCTTGGACAACGGGTCGACGATACGTC
GAGCCGCGATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCGACATAGTTGCTCACGTTTAGCTTCAACGATTGTCCTCG
CGGCGTCGTCTCCGACGCCACCGTGGTAGAGGAAGCAGCATCACGCTGCTCCTTCATGATGAACCCCAGAGCAACACCATGTTGCTCTGTCGGCGTTAGC
GTACGCAGCATCGTAGCTACAGCCGCCTCACCAATGACTGTTGACAGTCGTTGGAGAGCTTCCCACTCTGGGTCCGACAGGTGGGGACAGTCAGCGCGTG
CAACGTGAGTTGCAGGCATAGTGGAGCTCTCCATGGACACCTCCGTATTCATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGAACTCAGGT
AGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGCCTACTTTGGCTTTACCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTA
GTTTAACGTAGAGTTAGTTATACTCGTGCCTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTGGGTTAAAATGAGAGCTGCTATTTTT
GTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGC
TAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAAAGTATGTAGCATTTGGTGTGTCTACACCAAG
GT