Description :
From Genome Similarity Track
Location :
Scaffold_1591:336- 4272
Sequence
3936 bases(100 bases per row)
ATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACGGCTCTGTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGAT
ATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGAATGCCGTTTGGATTGAAGAGCGCACCCCAGATCTATCAACGTCTGATCGATAACGCC
CTCTATGAATTCACCCGAATACCGGAACCCGAAAAGGGTGGATCCGGGGAGGATCATACGGAAGTAGATCCATTCGAAGCAGGAGAGCCAGGGGATCCTG
GGACCCCGTCTGTGTTAGGACGCAGATCTTATATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGA
GGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTGAAGAGTTATTGGGGGATGCGCAAGGTGGATTACTTCGGCCATCGAGTCTCCAAGGAGGGATTG
GAGGCGAATCCTAAGGACCTGTCTTCGTTAGCCGGCTTGTCCTTCCCACAGTCGTACGGGCGATGCAATCCTTTTTGGGCAGTTTGAATTACTACAGTCG
GTTCATCGAGGAGTACGCACTGTTTGCTGCGGTACTATATGAACTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATCAAAATCCAA
CAAGCTCTAGCTCTGGAGATGTCGGATCCACGAAGGGATCCAAGTAACACGACGCCAGAAGAGGACCTAAACCAGGAGCTGGGATCCACTCCGGGATCTA
AAGAAGGAGGATCCAATCAGGATAGAGACGACGGATCAGAACATGGAACAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGA
ACAGAATCGTGACCACGCCTATCCTCCGTCACTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTTAGCAGCTCTGGT
TCAAGAACATGAGGGGATCTGCTATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCG
CTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGCGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCG
GGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAGTGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTT
GGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCCCCTAAGAAAGAGCCCAAACGCCGGGATCCAGATCCCGATCCCGAC
GGTACAGGTGGATGAGGATCTATACGTCCTGAGTTTCGATGGATCCGCTCGTATACGACGCGGAGGGAGGAGCATACAGTGCAATACTGTGGAGACTGCC
CGGATGGGAAGTTGTACGGGCCGGATCCACTTACGCGGAGGGCCTCACCGTCAATGAAGCGAAGTATAACGGACTTCTTCTGAGTTTGGATTTACTCAAG
GGACAAGATCCAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGT
TACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGAATCACGAGTTGGTGCATGTCAAGCGAAATTGGAATGCCAGTGCGGATAGCTTGGTCGGTGC
CGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGTCGAGCATCAGGATCTCGTTACGTTGAATCGACTAGACGAAGTGGTGGTAGTGGGATCC
GGAAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCTCTAGATCCTCGAGGAAACATTTGTGAAGAGAGTCCGCA
TTGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTGGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACTTAAGTCGGGAGGATGCCA
AATCCTACAGCATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGACCCCTACGAAGAGAGTCCACGAGGATCGGGATGGATTG
ATGAGATTGGTGATGCCAGAAACCTTTCAACAGGATGTCCTACACCACTACCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAAC
GGATCCGGGAATGTTTCCACTGGAGAGGACTATTCAAGAGCGTACAACGATATGTCAGTGAATGCGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAAT
CGAAGGGAGTCACCTGGGATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGAAAACACAGA
ATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCGCAACCATTGCTGAATCGTACGAGGAGTGTGTCT
TCCGAAGATTTGGAGCTAGCGAAATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCTTGGGGCAGCGACA
GCGAGCTACCATGGCATATCGTCCCCAAGCTAACGGGTCGGGCCGAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGA
TCAGAAGGATTGGGATGAGTACGCAGAGCGATTTCCCTTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACACCATTTTACTTGGTACATGG
GTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATAC
TACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGATGCCCGTCCACATCAAATCCAAG
TGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAGGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTTCTGGGTGAGCGAGAAGA
TCGGAGAACATGCGGTAAAGCTGGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATGCAAGCTGAAGTTGGTCAAAGAATATCCAG
ATCGGCCGCAAACCCGTCTTTCGGTGGATGGATCCGACCGGTTAGACTTCGACGAAGTCCTCCTGTCGGAGGATAGCTGGAATGTGGATCTCGAGGCCGA
CGAGTTCGAGGTCGAGAAGATCACCGATATGAGATCAGGAAAGCGAACTAGATACGGGCGGATTTACCGTGAATTTCGGGTGTATTGGCGTGGATATGAC
GAACCCAGTTGGGTAAACGAGACAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGCGGGATCGTACGAATCGTAATAGATTCGGCGTGATGCAAT
GTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACGTGTATAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTA
AGAAGAAGCGTAGGAAGGGGATCCATGGATGTGAGTTGGATATGTCGATGGGGGGATGAAGAAGGACCCACAGGAAGGGTGTGGGCCAGGAGGGGGAGGA
TCGCTGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAGGGTGGATTAGGAGGAAGGAGTGAATGCTTATGCATAAGAGTGACGTTCT
ACGTGCGAAGAGTCCTGCTTGATCTCAAGCGCGAGC