Description :
From Genome Similarity Track
Location :
Scaffold_1652:336- 3618
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1652-snap-gene-0.2F-box and wd40 domain protein
Pytul_var.sporangiiferummaker-pug3_contig_1652-snap-gene-0.3TPR repeat-containing protein

Sequence
3282 bases(100 bases per row)
TGAATTCAAATGCCGCGGATCGCTCGATGGCCACGTGCGCGGCGTTACACGCCTGAAGACGTTTGTTGTCGGTGCCGTCCCAATGTAAGTACTTGATTCA
CGTGCCTGTCTTTATACTTTACGCCGTCGTCTTTTATCCAAGCAGCTGACATCCCGTGGTTTACGTAGCCTAGCATCGGCTTCCATGGACGCAACTATCC
GATTATGGGACCTATCGACGTACCAGTGCGTGAAGCTGCTCTCCCCAGACGACAACGGGCACACAAACGCTGTGACGGACCTCGAGTTTTGGGTGAACCA
GAACGATACGTTCCTCATCAGTGGCGGGCTGGACTCGGAGATTATCGTGTGGAGCCTCGCGCCACCGTTCCAGCAATTGTTTAAAGAGACCCAGGACAAC
CCCGTGACAGCACTCTGTGGGACGCAAGACGTGGCCCAGACGCCGATTCTCCTCGTCGGCACAGCGGTAAGTACATCATCTGACGGCTACATACCACGAG
TTTGCGTTCTGGGAGTCTGATAGAGATTGGCTATTTGCTTTGGCGCAGGATGGTGCCATTACGGTCAAGGAATTGCCGTCCTTTGCGTACAAGACAACGC
TATCGGGCGCCGCGAACATCGGCCACCAGGAAGCTGTGCGCCGCATCAGCATCGGACCATTGAATACGTTCTTCTCGGTGGGCAACGACCGAAAAATGCT
CGCATGGCAGATCACGGGCGACGCAGCGGCGATTCAGACCAAGTAGACGAAGTCCAGCCCATTCCCAGAAGCAGCAAGTATGTCTCTCTAGGTCTCTGCT
GAGAATCGAGACCACGAAGTGCAACGAGAGAGAGTGAATTACAAGAAAACTACGAGAGAATGACATGCGCAGAGGCACAAGAACAACACTCGTTGGAAGA
AGAAGCTTTGTAGGAGCAATAGACACAGACATCCACCACCGAAAATGAAAGTTTACATGCAAAACTGCCAGACTTTTCTCGTCATTTCGCTTTTTTATTT
AGAGGTATGCTGGCAGTTTGCTTTTTTTTGCCAGCAAGCAGTTTTGAGGCATGGTTTTTGGCTTCACTCTATCGTGACGATGCTGCCGCTGTCCGTCCTA
AAACGCGGTCGATTGGTCTAGAGGCGGTGAAGACCCCGTCGCTGTATCACATTCTTGCTGTTACTCTGGGAAATGTGACGAGGACGAAGCGAAAGGAGAT
GATGACGGGAACGTTGGCGTCTCCACTGGTGTTATTGTTGTCATTGCCGCATCGGGTCTTCGTCGCGGACTCGTCTCGTCCGTCGAGGGGAAGCGGCTTG
GCCGCGCATTGACCTCTTCGTGGTCAGGCATTACCAGTTGGATCTGCTGGACGAGGAGCTCTTCGTTTCGCATTCGCTGCTGGGTAGCATTATCACCTAA
CGCTCCTATCATTGCAGTTTGAGAGATCAGTCCGAGCTCTTTCTGGACGCGCTGTAGCCACGTCAGTGCTTTCTGATACGACGAGTTGAGTGCATACGCT
TCTTCGAAGCACGTCGCCGCCAAGTCCAATTGACGCTTGCTGTAATGGCAAAGCCCCATATTGTGACTCGTGACGTGGTGTTTGCCCATTTCGTGCATCG
AGCGCGTGTAAAACGCCAATGCACTGTCGTAATCATGAATGCCGTAGTACAGGCGGCCAATCTCAAACGCAATGTCTTTCTCTTTGTCGAGTGCATAGTA
ATTCTTCCATACAAGCGGGATGCCGTGACGCACGTCCTTTTTCAGCTTTGGTGGGCACGCAGGCGAGTGGTCCAGCAGTACATCGCGAAACTTGTAAAAC
ACGTCGGGGTCCCAGCAACTGAGCTTCAGGAGCGCGAGCACAGCTTTCAAAGATGGTGCCTTGGTGTCTTCTTTGATCGCCTTCTGCATCACAAAGAAAT
CGTTCGGGCCGAACGCGATAATCTCGTCTTCGAACGCCACAGACACATTCGGGAACGCGCGACTTCGTGCTTCACAGACGCGATCCAAGTCGTCTCCGTA
CAGCTCGGCCATGGATGTCGAAGGTGGTTGCTGCGACTGGTCTTGGGCAGATTGTAATCGAGCGGGTTCGCCCGGAAGCACAAACATCGATACCTTCAGA
CTCGCTTCTTCCTGCGGACTGTGCAGCGCAAAGCCGCCGCGACTCGCAAAGTAGATGCCGATTGCATGGTAATTCACCATGACCGAGAAGCTGCCATGCA
CTGCAATGTGAGGGTCACAGACGCCGCGAAAATGGTCGGGATTGCTGTTGCCCTTGTCTCCCGAGATGACCACGACTCGGTTCGAGGACAGCTGGCTCAA
TCGCTCAATCGCCGAGAGCGCGCCAATGGGCACGAGCACCGTGGCGCCCGACGACTCTGGGTCGTAATACTCGTGATACCATTTCAAGATGTTGTTTAGG
TGTGGGTTCTCCTCACCGTAAAAGGTTTCATCAATTTGCTCGTACTTGTAGAGATTCGAGAGGCGTTTAATGATGTCTGGATCCAGTGGATCAGGTTCCT
GCGCTTTTTTGGAGCCGACACTAATGAGCCCTTCCTTGAGAACGCCATGCTCGACTTGGAAGAGATCATGGTACAGTGTGTCAAAGAGGTAGTTTGCAAT
GATGCACAACGGATTCTTCAGTTGGTGCGGGCGCAACACGTCGTTCGACACGGCCAAGTGCAGCTCCGTGTCCTTCGTCGCATCAAAAATCGCGAAATCT
ACGATGCCTCGTTTCACGAACGGCGCCAGAGCAGGATGCGTCTTCCAAAAATTAAAGTTCTGCTCCGTAAAGTCCGTCATGACGTACTTGATCTTGTCCA
ACGGGAAGTCTAAGACGCGCTACAAAACACACAAAATAAACCAAATTTAGCGAGCTGAGTCTCTGCTATATCGGGAGTCAAATACGAGCATTACAACATA
CTTCAGCTTCAGCGAGGGCCTTGAGGAAGTAAAAGCTGAATTTTCCTGATCCCGTGCCGAGCTCCACGATGTAGAATGGCTCAGATGGGTCCAACTGGTG
GCATACAAGAGGAACATTAGCACAATGTCAGTCCAGTTTGGTGTTAAGAAGAATCACGAGAGGCGAGGCATACCGGATACTCGCTTCCTGGTCGCATGAC
ATCGCGAAAGTAGGCACGCAGCACGTTGCTATAGCGCTTCGCGATGAATGTGTTAGACGTGATGAAATGCGGCACAATGCCCTGGGCCCACGACTCGACG
CCCTCTCGATCGTAGAACGACATCATGAGTTTCCACAAGTGGCACTTGGAGAACGGTGTGAAGCCCTCGAGTTCACAGCGTT