Description :
From Genome Similarity Track
Location :
Scaffold_509:336- 1344
Sequence
1008 bases(100 bases per row)
GGCGTGATAAGACGCTCCGAGAGAGCATACCCACTATCACCAATCAATTATTCACTGCTAGAGAAGTACCGCTCAGGGTTCTTGCCGACTTGAGAATGTG
AGAAGACCAATCTCCACATGACCTGGCCACCCCGTGATGGCCATCAATTTTTGGGAAAAGTTCACGTAGGTTCCGTCCACAAACCCAACACATCCGCTAA
GACCATAGCGCTCACGGTGAAAAGCTGATGACGTCACTCGCTTCGTTTCGGATGGCCACGCAACAAAGCGTGAATAGTACCGGAGTAGCGATTTGCGAAC
ACGCTCGACAAACTCCGAAACTGTACCAGTACCGAGCCCGTAGGTGTGAGCGATTCGCCCACACGTGTTGCCGTTTCCAAACGTGCCACACCATTCCAGC
GTCACTGCTAACTGTGTCAAGCGCGCTGTTCCAAGAAGCACTGCTAGAAGAGCTTGATGACGATGGTGAAAGTGGCAGCTGGAGCGAGTCTGAAGGCAAC
AGCAAGGGCGACGACGACGAGTGGGGGCAATTTGATGCTGAAGGAGACGAAGCTTCGGAACTAGCCGATCTCTACACGGGCCTAATGCAGACGCGTTACA
CAGAGCCGCGCGAAAAGCAGCATCGCTCTACCTCACACAGATACAACCTCTTTGAGCAGACCCCAAAAGCGTTTCGGCAATCCGTTCGTGTCGATGCTGC
AACGTTCGACTACCTGTTGAGCTTGATAGTAGATGATCCTACCTTTACAATGACAGCGAGAATCCCCAGACCGACATCGCGATCCAGCGCAGACAATCTT
GCTTTTCTCGGTGGCGGGCATGCTTCGGTATGCTTCTGCTACCAGACCACGACGCAGCGAGCCTCAAACGGAAGCAGCTTGCCCCACGATGAAGTGTGGC
GACAGACTTGGAGTGACCTGCCTAAAGAGTTAATATGGCCATCAGTTATCTATGAGCATCAATCCAGTAGCGACCTGGGTCTGTCTAGCGATGCTTACTG
CCTTACCT