Description :
From Genome Similarity Track
Location :
Scaffold_31:335961- 346745
Transcript NameFunction/comments
Phyci_114674metalloprotease family M01, putative
Phyci_79861conserved hypothetical protein
Phyci_308236hypothetical protein
Phyci_92328Hypothetical protein
Phyci_273440endomembrane protein 70-like protein, putative

Sequence
10784 bases(100 bases per row)
GTTGAGGCTCTTCTTCCAGTCTTCAAGCGCAGCAGGTGTCGTCGCTGGCACCGCCGTCTTCGTCTCCTCCGGCTGCGCAGTCTCCATCGTCATTATCACA
CTCAGTGGCCCGCCGCTGTAACTGGTACCGCTTGTACCAGTTTTTGAAGTTTCAAAAAGGCTAAAGCTCAACAGCCATGCAGCGCGGCCGACGGCGGCTC
CGACAGCGGTAAGCGCGCACTTCCAGCAGGCTGTAGAGGGTCGTTAGCCGACTAAAAGGTTGCGTGATGCTGCTGTATTGATGCTGTACAGGGCGGAGCG
AGATCGCGAGTCCATCGGCAGCAGCAGCGGCTCGGACGTGGAGCTGCTGGCCAAATCCGAGGAGCTACAGCAAGATACTCGGCGATTAAAGGAGGAAAAG
GAGAAGGAGAAGGCCGAAGCATGGGCGTGCCAAATGTGCACGTTTGTTAATGAAGACGCCAGCGCCTCCAAGTGCGAACTGTGCGAGAGCGCGCGGCCTG
GACCGCCACGGAAGACGCGGAAGCTGTCGCAGTGGCTCTCGCAGCCAGTGGAGAGAACGGAGAAGAAGAGCAAGAAGAAGGCGTCATCAGGCGCGCATAC
TGAACCAATTGAGGTCATTGACAGCAGCGACAATGGCAGTGACGATGATGCAGCCAGTGTCGCCTCTGCTGCGTCTTACAGTGAGGCTGCACGTGCGCAC
ATATCCAACGGCAAAGCCTCCGGGATGGCACCAACATTGGCGTCTAACAAGGGGCTATGGGCTGATTTGTACGCTCCAAAGACCGTGGATGAGCTTTGTG
TGAACAAAAAGAAGGTGCAGGAAATCTCAGAATGGCTTGAGAGGAATGCATCGCCATCGGCGGGTGTGTTCCAGAAGCGGTTGCTGTTTTTGTGCGGTCC
ACCGGGGTCAGGCAAGTCGACGGCAGTGCGATGCATTGCGCGGAAACTTGGACTACTTGTGAAGGAGTGGGAAGACAACTCGGCTGCTGGGAAGCTGAAC
TACGAACGGATGCTGCGAGAGGATTTTTGGCTACCGCAGGTATCAGGTGTTGACGATTTTTCAGACTTCATTCATCGTTCTTCGGCCTACGCAGCACTTC
CAATGGCCACGTCGAGACATACCTCTTCTATTGGCAGAAAACGTCCGCTATCGAGCAGTCAGCAAATTTCAAAGAGCGCTAACGTTTCATCAAGTGACTC
CGGCCAGTTAATCTTGGTTGAAAGTTGGCCGCAGTCATGGTCGAAAAATCCGTCACAGTATGAGGAGAAACTTCAACGCATTTATCAGCACGTAGTAGAT
CCGGTTGGTGGGTTCCGCTATCCTGTCGTTTGTATCTACAGTGACGTCCAAGGAAGCAAGATTGATCTGGATCATTTGAGCCGGAAGTTTTCACGCGAGG
TGATCCATTCGCCACTCACCTCGGTCATCAACATCAATACAGTTACATCTGCACAGCTCAAGAAAAATCTTACCCGCGTTGTAGCACACGAGAACTGTGC
TTCTCAACCGGTGGATATCCAGAAGGTCATCGACAGCAGCAATGGTGATATGCGCCACGCGCTGAACATGCTGCAGCTATCGCAAAATCCTACTCAGAAG
AAAGCTAAAGTAACTGCAAGCAAGAAGGTCAAGATGAGCAGTGCGTTAACTGGAACTTCCGAGTCGAAATCCGCAAGTTCCACTGCTCGAGATCCATTTC
TCTCAGACTTTCACGTGGTTGGAAAACTGCTGCACGGCAAACTGCTGCTGAACAAGTCCGTTGATGAACACGAAATGAAGAGTGGTGCAGATGAAATTGA
TTATGACCAGATCTTCGATGCTTCGGCGATGCCTCTCGATCGAGCGCTTGGGCTTGTTCATGAGAACAGCATTGCGTATTTTTCGCAAGTGGAAGACCTT
TCTAGCGCTCTGGAGCTGATGAGCTTGTGCGAAGTGATGGTCGCCGAATCGTACAATGGTGTTAGCAACTCGGAGGTATGCTTCTCCATTTCTCATACTT
GTATATCGAGTTCTTATCGAATGACGTTTTTTGTAAACTCTAGGCCTTCAAGCGTTCAAGGGATGTTGCTCAGGCCATTCTTATGCGGACTGTAGCTGTC
ACGAACGAAAACCCTGCCCCAAAGGCGTTTCGACCGATCACGCGACCACGAACGTACGCTGCGAAGCAACGCATAGTCTCTCGAAGAGAGGAAATGCTAC
AGGCAACGCGAGGGGGAGAATTAGGGCTTCAATATGCATGCACTGGGGATGTTTTCGCATTTGAAGTAGAACCCTTTTTGACCCTTATGGATCAAGCCGG
TGGGCCCACGACCCAGTCGAACGCATGTAGCTCCACCTTTGCAGTTGATACCCTCTCCATCCGGGAAGAGGTCGACGATGCAATTGAGGACAGCGATGGC
GAGTGGTAATTGTCCACCGGCATATTATTCACATTAAACAATTTTGAACTCTACGGCGACTACGGCTCAGGTGTTGAGGTCGAGCTTGTTGTGTTGGGTA
TCGCGGCGGATTTCCGGATGTTGCTGTCGTATTCTTTTCTCTTGGCAAAACTACTGTTCTTGAACTTGTCGCCCTCGTTCGTGTTAGCGCTCGCTGCCGA
AGTAGAGATCGTGTTGACAGCAGAAACTACTCGGTCCTTTTCCTTCTGTTCAATGAGCGAGCTGGGTTTTCCCTTCTTTGGAGTACTCGTGACACCTGGA
GCGGTAGCCTTGGCGGCAGTGCCTAGTGGGAAGGGCAAACCTGGCGAAATTGTGGCTAAAGTTCCCGAACGAGACTGAGTGTCATCTTCAACTGTTGGTG
ACGGCAATTCCAGCAGTAAACTTGTTTCGTGCCCCACCCAACGGACAATATATTCGCCGTTGCGCTTTCGGTTTAGGTCACCCTGCAAGCGCCGAGTTGC
TGCATAATGATGGCTATGGCCCGAATTCGGTCCATTCATATGAGCTGAACCATCACCATCGCGTAATTTTTTCTCCAAGTTTGCGAGTCGCTGGTGGCAG
TTCAACTGTCCGAGCGAGTGTTTATACCATTCGTACAGTGTCAGTGCCTTTGTAAAGCAATTGTGTGCACCTCGTAGGTTGCCATTCCGGGAGTGGATCA
TGCCGATCGCGCTTAAAGATGCCGCTTGGCCAATCTTGTTCCCCACCGTTTTATACAAAATGAGCGCAGAACCAAACTGTGCTTTCGCCTCGTCAAACTT
GGTCTCAGTTGTGAGTAAAACACCCATCAACTTCCGAATATTCGCCTGACATAGAGTGTTCTTATGCTGCTTGGCGATGTGCAGTGCCTTGTTAGCCGCA
TTCCAAGCGCCACGGTGGCGTCCTGACAAAAACAGAGCGTGTGCGAGGTAGCACGCTACGTCCATCACATAACCTGCGACCTTCTCTCGCAAGTTGATGG
CATCGACATTACCGCTGTCTGCATTCGAGCTAGTATCCAAAAATATTTTTGTTGGCCTGGGAGATGATGCTTTGTTTTCCGTCTGCCATTCTTCAATAAT
GCGCATATGGAGATCCAGGATCATCCACAGGTTCGACTCGTGCAAATCCAAGATTAAGTAGGCGGCACTGGATTGGATTGTCAGCGTACAGATGTGCTGG
AAGACCCAGAAGCTGACTTTCCGGAAGTGCTTTGACGTATTATACAGGAACAGATCTCGGTCAGCAACGCAAAGTGACTCCAACACCTCGTTCTTCGCAC
CATCTCCGTCATACACGCCCAACAGACTCCGAGCGTAACTTGCAATGAACGGGAATGTCGAATACGAAACACACACAGCCATGAGTTCTGCTTGGTCATC
CATGCGCTCAACGTGTTCTGAGACGCGAGATGCACGTCCACTACGTGTCAGCGAATTCAGCATGTTTCTATCGTTCAATACACGACGAGATCCTCCCCTG
CCATTTGGGACTTCGTATTCGGCGTTGTCCACTTTACCAGATACCTCAGTAGCATTACTGATAAAGTCGCTGTACGACTTCAAAGCTACCAGCAAAGAAC
TATCGTACCCTCGACTCGAGGAATGGCGTGATCTGGAACTCCTTCTGGAGCTGCTGCCACTACTTCCCAGCGGACCGGCTGTGGAATTACTTCTTTTGGG
TAGACCACGCTTCGCAAGTGCAAAACCTGGGATACGATTCCGTTGAATAAGTGAAAAGCGCAATAGCGTCTCCACCAATCCTTCCCAACTACTTCCCCAC
AAACTTTTAAAGTCTGCCGGCATCGCTCCAGCCGGGAGTAACCCTAGAAGAGCAAAAAAACGAATAGCGTCTTGCCCGTGGTGCATCCGAACTTGCTCCA
GCGAAACATCCAGCGAAGCGACGAGAGTGTTTAGTGCGCTGCGGTCATGTGAAGCCAGACCCACCACTTGCAATTCGTTTACACCGCGACTAAGTACAGC
GCGTGTAAGCTCAGAAAGAGATCGATCCTGGAGCAAAGGTGCGCACAGAGATATGGCTTGGGGGTGACCATCGAGGAAGGCCATTAAAGGATGAGCAACC
AAAGCCTCCAAAATTGACGTGGACATTGAATGTGTTCTGCTTGTATCAATATCACCAATTTCAGACACGAGAAGAGCGCGCGGGGACTTCTTGATAAACA
AATCTGCAGCATGGTAGTGTGACAAGCGATTGAGTGACACTACCTTTTCATCGAACTCATTGATACCACCGCCCATTGCTTGCCGCGCAGTCATCAAAAA
CGACAACGACGGCGTATTTTGCAGCAATTGCAACAGAAAATCACGAATAGCCGACGGATTCGCATTGATCGGGTCTTCCATGTTGTCCATTACAAGAAGA
ATTTTTGTATTAGCAAGCGCCTGATCGAGTGGCATGTCCTTTTCGCGACCACCTTCCGGGAACAGTGCACTCTTGATGGCCGACTCCACTCCTTCCAGTG
ACTGGACACCACGCAAACGAATAAAAGCAACTCCATCGGGAAATGCATTGCGGTCCGCCAGGAAATGAGCCAACTTAATCGATAACGTGCTTTTGCCAAT
TCCAGGCGGTCCCCGCAACGTCACAAGACGCCGCGTGTTGACAAGCTCTGCTAACATGTGCAGTTCCTGTTCTCTACCTACGAACGATTCTGATACAGCA
GGGAGAGTCTTGCCAAATTTGTTGGACGGACTGACGTCTACCCACTTGCCCACCGATATGTCGGAAAAAACGAATTGCTGCGTGGAAGCAGTACAGCTGC
AAGTTTTCTCCATAAAATCCACTTCAATTGTCTGCGGCAAATCCCCACTGGACCAAAGTGGGCATGTTTCAGCGTGTAGTTGAGATGATTCCAGCAGCAC
GAACTTGTCCCCCTCGCCATCGGGGATCCGCATTTCCGCGCTCACTCGAGCGCGAGCGATCTCAAACGCTTGTTGAACTGTTTTCCCGGTGAGAGCTGCA
TGGTAAAACGAGTACGAAAACATGGCCGACGACTCGTCGAGCACTCTACCCTCTGATCGCACGCACACAACGTGTGCTACACCGGCTTGGATGAAGACTT
CACCGATATCTCTCGAGTCACATGACGACACAAATACCAGCTTGAGTGTACCATTCATCCCAGGGCGACCATCCAAACTGCGAGAGGACGAGACCGTAGA
TGGGGTCCGTGGCAGAATGCCAAGATCACTTACTTGGTGTACACCATCCTCCTCGACAACTTCTAGCGCACTATTCTCGCTGATACTCACTTCCTCCACG
GTAGAAGGACTCATACCGCTGTTCAATATATTCCGCAAGGTAGCAGAATCCACCAAGTGCGCCAAGCCAGAACATTGCGTGTCCTCGAACATTAGATGTT
GGCTTTGGCCAACAATGCGGCCTCCATGCCCGCTGAAGTGCAGCACAGTCACTCCACGATCCAACACTTTGCGCAGCGCATCAACCGTCGCCACCGCCCG
CATTGTGTGGACTGCACGCTGGCATTCCTGGAAGATCTTGCTCAAGTGGCTTTGCTCCTGCGCGATGTTGAGCGGTGGCACGGGCTTGAGCCGACGGTTG
CTGTCGCTCATCACGAACGGCAGCGAGTAGAGCGTGGCGAGGTCCACCCACGTGTTGTGGATCCCGTAGACGCTGGAGGTCTCGGTGGTCGTCGTGCAGT
CCGACAGCGTGTCGCTCTTGTCCTCGCTGGTGCTGGCGGTTGCGGCGCCTCGGTTGGGCTGCTCCACGCCGTCGATCATGCGGCGAGCGATGCGCTCGTT
CACGGCCTCGTACATCTTCTCTTGGGCCTCGGACGTCGTCGCCACGGCGTGGTTCTCATGCTTCCTGTCTCCGCCATCAACTGCTCCATTGGACGCAGCA
ATTGCAGGAGCGGGGGCGGCTGGGAACTCGTCGGTTCCGTTGGTCTCGCGCCTTCTGGCCAGCAAATCGCGTGCCTGCTGCTGGATCCGCTCTAATTGGG
TCTCGGGGGACTGCGCGGGGGACGCGGGGGGTTCCGCCAAGGCCTCGATGAACGCCCACAGCTCGTGCGCGAGCACCGGCGGACCGGAATTCATTGCGAC
CGCCGAGCTGCGCCCGATGACACGCGTGGGGCTCCTCGTCTCGTTGCGGATTGTGGTCCATCATCGATGAGCATCATTCCGCATTTTTAACGATTTATAC
AGGCCACATATAATGTTTTAAAGGTAGCTGATGCGACGTAGATGGCTACATTTGCATTTTTCATTGGCAATGACAGACGCGGACGACTCGGGCGACGGCC
TGTGGGGACGGCCCGACGACCGCGAGTTCTCGTACTTGGTGAAGGTGCCAGGCACAGCCGAGCAGGTGTCGCTGACTGCGGTGCAGGACCGAGACGTCTG
CGCTGGCACGCCGGCGTACCCGTCGCACGGCCACTGCGTCTGGGACGCCGCATTGCTGCTGGCGGACTATCTGCAGACCAAGGCTGCCCAATCGACGGGC
GGCGTGGACGGTGGGGACCGGTTCCAGTTCCGAGGGAAGAAGGTGGTGGAGCTCGGCGCGGGCGTCGGACTCGTCGGCATGGCGCTTGCTGTGCTCGGAG
CTCAGGTCGTGCTCACCGATCAGGCGTACGCGCTGCCTCTGCTTGCCAAGAATGTGGACGTGAATTTCCGTGATAAAGGCTCAATTAATGCACCGACGGT
GGAGAAGTGCCAATGGGGGGAACCCTTTGAATCGGGCGGCCGTCTAGCGACGTGGACGAAGAGTACCGACGTGGTGGTTTTCTCGGATGTACTGTACCAC
GCTTCGGCGTTCTTGCTGCTGATCAAAACGCTGCATGAACTGGTGTCGTCGACGACCGACGTGTTCTTCAGTTTTGAGACGCGGAATGCGTCGATCGAAG
CGAGCTTCTTGCAGCAGCTTCGCCAAACGTTTGACGTGCAGGAAGTTTCGCGAGCAGCAAACTCCCAGGTTTTCGCGACCTTCGAGTACCCGAGCGAGCT
TTTCATCTATCATGCGCGCCTAAAGGTTAGTGGATAGACTCCGTAGGCGCCTCAAGACTGGTAACAAATAGCATCATTGCGTGATTATACATGTACTTTC
GTTCTTGGATATGGCATTGTCACAACCTCGCCATCGAGGCAGGAGACAGCCCTTCGCTGGTATGTGTGGCTGGTGCGATATCTTCGACGTGGCTGGGAAG
AATTCGACCTTCGAGGGGTGTGTCCTTGGTTTTCCGATAAACGTTGTCCAGAAAGACACAGACCGCGTCGCCGTGCGCTAATGCTCGCGGAGACAGCAAA
AAGTTAAACATGTGACTTGCATAGGGTACCTTGACGAAGACGTCCTGCACACCACCAAGCTGCTTATCCTGGTACCATGAAATACTCTGGGGAAGGTTGT
GTCGGAAGTGGCGCAGGCGATCGAAAAAAACGCGCGAGTCGGTGAAAGCAACGGTGTTGTCGTGAGTTCCATGCGTGATCATGAACGGCGGAATAATATC
TCGACGACGTGCTGCCCGCTCGTCATCCAGGTAGGCAATTGGCGACGCACGCTCAAAGTCCTCGCTGTTGCCCTTGAGCTTCTTCTGCATGACCAAAAAC
TCAAGGTAGCGAATGAGTCCATGCGTTTTGTCGCGGCTGTAGTAGATACCATGCCGGTCGGTGAAGTCATGAACGCCATAGTTGTCGACCACCGCGCGCA
CACTAGTATCCACTGCCTCAAAACCCGGCTGCAGAGACTTATCATCGGCAGTGAGACCCATCAAACTAGCCAAGTGTCCGCCAGCGGATTCGCCGCCCAC
CACAATAAACTCTGGATTCGCCTCGAATTCCTCACGCGCGTTGTGGCGGAGATAAGCAACAGCGCGCTTCGAGTCAATTAAGTGCGTGGGGAAAGCCACT
CCTGGCGATAGTCGGTAGTCGATTACACAGACTACCCAGCCCATGGAAGCGACCTGGTACACGCAGGTAAACGGCGGGATCCGGCGATCGCCAATGACCC
AACCTCCACCGTGAATGTAAAGGAAAATTGGCGCGTTGGCTGGTGTATCTCGATGCTTGTAAACGTCCATGAGTAGTTTCGTGGTCTTGGTGTTGCCCAC
GTGTGCGTATGTGACCGTGCGGATTTTGCTGACTCCGGGAAAGCTCAGCGATACGGCCATGGGCTGGGGCAACGGCAGAAACACGCTGAGCCAGCGCTTC
AACGACATTCGGCCGATGTTCTCCAGTTGCGTCGGCGCGATATCGGAGGCTACGAGGGCATCGCGAATGACCTCCTTCGAGGAGAGGTTCTGTCGGTACC
ATTTCGCAAGATTAGCGGCCACCACGCACTGCACGAGGCCTGCGAACGCGCCGCTCCAGCGCGAGAAGATGGGCATCTTCTTCTTGAGCAAGAAACCCAT
CAGACACGCGTGCATGACTGCGATCTTGTGCGACAGCTCTGTGGGCAGCAGCGACGCCGCCATCCCGAAGAAATTCTGCGCGCACAACAAGTCAAATCAT
TAAAACGGTGCGTGCGCCAGGTGCGTGACTGCAGCTCATTGCGCACCTCGCGCGGGATCTTGTTGTTCTTGGCGCGCTCCACGACGTAGAGCGTGGAGAC
GGCGAGCGCCAGGTACGCCCAGCGCGTCAGGCGCTCGTTGCTCAAGTAAGGCGAGGGCTCGGGCTCGAGCTCGGGCTGGATGACCTTCATCTCGGCGCGT
GGAGTGGTGCTGACGGTGGTGCGGTAGCCACTGTCGAACTCCCTTGAAGGGAGGACCTCGCAATGGACGGCGGCGGACTGCACTGGGTGGACTGAGATCG
GGAAATGGCCGTCTGCCCGACGTGAGCAATACAGATCTCAGATGACGCCCAGTCAAAAATGTTTAGTCGACAAAAAAAAGTGTAATTGGTGCTTGGGAAA
GCTGAAGCAGTTGCCACGCTGGCCACGTACACTAGGAGGTAGGTCACCTTACGCTACACTATGTGTCACAGTCGCGCCGTGGCGGCGACAGCCACCGCGG
CGTCTGTGGCTGCCTCCGCCAGCTCACCCAAGTTTTGAGGGTCCAGGTCAGTCACGCTCGACAATGGAATGTCCTTGGTCTTGCCGTACAGGTTGTCGAG
GAAGGCGACCACGGCTTGGCCGTGGGCGATCGCGCGCGGGGACATGACGTAGTTGAACGCGTGGTGCGCGCCTGGGATTTCCAGGAAGACGTCGCAGACG
CCGCCCAATGGCGCCTGCTGGGCGCGTTGCCGGTACAGCTGCAGCTGCTCGAAGAAGACCTGCGAGCTGCCGAACGGCACCAGCGTGTCCAGCGTGCCGT
GGGAGACGAGGAACGGTGGGATCACGGCCGGCAGCTCGCCCTCCTTCTCCTCGCGCAGCCAGCCGACGGGCGACGCCTTCTCCCATTCTTCGTCGGCGTC
GCTCATCTTCTTCTGCATCACCAGCAGCTCGATGAAGCGCACGAAGATGTGGTCCTTGTCCTTGTAAAAGTACACGCCGTGGCGATCCTTGAAGTCGTGC
ACGCCGTAGCTATCGATGCAGCCACGCACACTGGTGTCGACCTCTTCAAACCCGGGCTGCAGCGATTTGTCGGCAGCAGTGAGCGCCACCAAGCTCGCCA
GGTGACCGCCAGCAGACTCCCCTCCGACGACGATGTAGTCCGGGTTCGCATCGAACTTCTCCCGCGCATTTCGGCGCAGGTACGCGATGGCGCGCTTGGC
GTCGATCAGGTGCTCTGGGAACGCGATCTTCGGGGACTTTTGGTAGTCGAACACGCACACCACCCACCCACGAGCAGCAATCTGGTAAAGGCATGGGAGC
GGAGGCGTCTCGCGTGTGCTCATGACCCAGGCGCCTCCATGAATATACAGCACGATCGGAGCATTGGACGGTGTATCTCGGTGTTTGTACACGTCCATGA
GCAACCCCGTAGTCTTGTTCTTGCCTACGTGTGCATAGGCGACCGTCTGCACCTTGGCGACTCCAGGAAATGCCAGCGAGAGTCCGACAGGCTGAGGAAC
GGGCAAGAACACGGCCAGCCACTGTTTCCAGCTGATCTCGCCAATGCGCTGCACGCTGTCCGAAGGCACATCGGAGGCGTGCATTGCGTCCCGGATCACG
TGCTTGGTGGCGATGTTCTCTCGGTACACTTTCGCCAGCCGGACCATGACAACGCATTGCAAGACAGCAGCAGTCGAGCCGACCCACTCGGACAGCACGG
GCCTCTTGGACTTGTGCAGGTTGTAGATGATGGCAGCGTTGACGGCCAGCAAGTTGTGCGAGAGCTCCGTGGGCAGCATCGCAGCGAAGAAGCTCAGCAC
ATTCTGCAGCAGTAGCAGCAGCCGTCAATACATTGGCGCCGAGAAGGCCAGCGAGCGCAAGCGTACCTCTCGCGGGATGTCCTT