Description :
From Genome Similarity Track
Location :
Scaffold_111:33593- 35097
Transcript NameFunction/comments
Phyta_totarag3816conserved hypothetical protein

Sequence
1504 bases(100 bases per row)
TCCACCTAACTCACATTGAGCTTCACATTGAGCTCCAAGTGCCCTCCGCTCTGGGTCGCTTGAGGCACCCAAAGTGACATTGAACCTCCTCCAGTGCCTG
GAACATCCAGGAATCCTGGTCGCCAGCGATCAAGGTACAGTGTCCTCCCGCCCAGTGTTGTGACTGTGGAGCTCCACGTTGCAGATCCACCAGGGGAGAC
GTCTACTTCGTCGATTTTCTCGCCGCCAGATTGGATGTTTACAGTCACGTCGTCAGTATCGCTGCTCTGGAACGTGATGGTGACGACGCCGTCACCCTCT
TTCGTCCAGGTGCCAACGCTGTCGTTGAATGCGTCGCCAGCCATTGTCATGCCCAGTGCCTCCTCTGCGGTCCCGTCATCGATATCGCCAATGAACCTGG
TGGGGCCGCAAATTGTTTGGAAGTACCCGCCAATGACGTTGGTGATACCAGTGACGTCCCAAACACCGTAGAATGAAGCTGCTTTGTCGGCAATCTTGTA
GGTGTACCCCTCGGCAGTGAGGTAGGTTCCGTTATTACTTGTCCCGGACTTGATGAGGTCCTCGACGATGCCACTGAAGGTCTTCCTCAATGTGGCTCGA
GTGGCGAACGCTGTCGCCTCGTCCGATTCAGTGATCAACTCTGTCATGCAGTTGTTTGTCACAATTGGGATGTCGTTCAGGAAAAGATTGGACTTGCTCA
TGGCGACGCGCAGATCATTCTCCGATATCTCTGGGCTCTGCTGGCGAAGAGCTGCCACGGTCATCCATGTGCGGTCCGAAAGGCGCTTCATGTCATACCC
GCAGGTTGTATTGGACTTCATCgccgactgcagcgacgtgatGTCAGCCTCTTTCAAGCTTGAGAGCGACTCGCCCAGCGCAACTTTTTCCATGAGCGCT
TTGAAGGAACTCCAACTAGCGACGATGGCGCCAGCGTTGGCGATGACTTCCTTCAGGACCAACTCGGCGGTGGTAGTCACTTTGTCAGCATATTTAACTC
TTTCATCCACCTTGATCCCAATATACGTGCAAATCGTCACAGGCAAGTCGAAGACCACGTTGTCCGTCTGGTACAGCATTGCCAGTAATTGAGTCTGCGG
GTTCGTCACCTTGATATTGCGGACGTACTTGCTGAGTTGCTTCACCAAATTGGCCATCTCCTTTGCACATTTGAAGGCGGTTTGAACACCTTTCGCCATC
AACTTGAATTCTCCATACAAGCCGAACGTGGCGAGAGACATCGCAGACTGAAATACCACCGAGACTTTGGACACGATCTCGAGCTTGCAGTCGTCGTTCT
GTCGGATGCACTCCATTCCACACGTTACGGGAAATGTGAGCGGGCACTCCGCCCAGCAGGACTCGAACTCGCTGTTAAACTCAAGAGGACACGTACTAGC
GATGTGAGCTTCGCGATAGCACGCCGTATCCGACGGCGTACTAATGGGGCCGACCCAGTCGACTCGATTGTACTGactgcagttgttgcagaGCCGATCG
TAAA