Description :
From Genome Similarity Track
Location :
contig_38:335903- 345234
Transcript NameFunction/comments
g7125.t1RNA polymerase-associated protein CTR9
g7126.t1hypothetical protein PHYSODRAFT_284208

Sequence
9331 bases(100 bases per row)
ACCTGAAGGGTATCGCCAATTGGTGGCCCTGGTGATTGACATGACGCAGCTAACCAAGCTTAGATTGAGCAACACTATCACGGATTTCGACACGAAGCTG
CTTGTCGACGCAGCACTGCGTGCCCCGAAGCTGGAACAACTGTTTCTGGAGCACAATGAGCTGGAAGATGATGCATTCTTGGGGCTTGCAAAACTGCGAA
AACCACTGGCACTGCGACACCTTCGCCTCAGCGATAATGACGTGTCGCCTATAACGCTGGGGGCGATCTGCAGCGCCAGTATGGATGGCGTACTGAATCT
GGAGAGACTTGAACTTACCAACAACGTGCAGATTGGCGATCCGGGTATACACGCACTAACACCGATGCTGGCTTCCCCAAGCGCTGGACCTGTAGCGGTA
CTTACGCATCTAGACGTTCGCGGCTGCAATTTTGGCCTCGAAGGGGTGACCGCCTTGCTGCTAGCGCTGGGGCGCAACAAGACGGTCAAACACTTGAACC
TCGCACAAAACTTTTTCGATGTTGGATTTGGCGACGTGCTCGCCGATTTTCTGGTCACCAACGACTCGGTCACAAATCTGCAAGCGAATGGCGTTGGATT
GGGTTTGGCAGGTGTGTCTGCTCGGCTGTTGACAGCATTAGAGAAAAATACCATACTCACATCACTATCGTTAGGAGCGAATCGACTTCGAAATGATGGT
GCGTCTGCGCTGCTGCGAGCACTCGTAAAGCGTGCTGAAACAAAGCCTTTCACGCTGGTTGACTTGAGTGGAAATCTTCTCACGTTGAGTGGGCTTGCGA
TGCTCACTGATATTTTGGAGATCCCTGCTAGTGCGGATCATGCTCGCCCCGGTTACGCTAGCAGGAGTTGTATTGACGGGCAAGGACAGGAAGTTTTGGC
AGATCGTAAACGACGGCGTATCGGTAGCTTCGACTACCACAACTTGTCGAGTCCGCTTAACAAGCCAATCGAAGAGCTATGCTTGCTGAATAACGATTTC
ATCGGAATCGATGACGAGTACGCGGGTGACAGCTCGACACTAATAGAATCCATCCGTCGCCGCGTAGGGCACCTGAAGAGTAACGAGTGGGCAATACAGC
ACCAAGTCTACGACGACGAAGTGTAAAGCAAATACACATATTCCGGCACTCAATATGTAAAATTCCTGACGAGCTTCTCACACCACTCAATGAAAGGGTG
TGTTCCTCATTGCATCAATAACCCACCTAACTACACAAAGTAGGATAAGAGAAATCCAAAGGTTCCTCCGAACCATCGACGTCGACCGTGCAGCACGCAG
CATCAAAATTCACACCACGGCAATGCCACTGAGACTGTTCTTTGACGCTGCCACCTACCTCTCGAAGGATAACGACTGCATACTCGGATAGATTCCGAAT
TCGCGGTCAGTGCACTGGAGCTCGCGCCATTCACGACCTTCCTTTCGCTTGATGAGTTGGCTCTGTTTCTCTCGTAGCTCCACGATCTGCGAATTGTAAG
AGTCCAGTATGTCTTGCAATGGATGAGGAGGTTCATCCTGCTCTCCATCCGAGCTAGTGTTATCAATATCGTCCGGCACCTCAACGTCTTCGTTTAAGTC
ATCATCATCATCATCGTCGTCGTCGTCATCCTCTCCTTCGTCGTAACCTTCATCTTCTCCGATTTCGTCTTCCTCTTCATCATTGGCTTGGGAATTCTCC
TCGTCCAGGCGGCGCTTCTTTGCCAAATCAAATCTCTTTCCATATTGTTCATCCTTGCCCCGCTTGGATGGTTTCTTTGAGCTATCAGAAGTAAATTGTC
GTACAAGCGGATACGGATTGTTATTGTCTTTGGAATAGTGGCCACCCTTCGCATCAGATATATTGCTTGACCCCGACCCTGCAAAGGGAAAACGCACAAG
ATTCGTGAGATACTCCAAGAGATAGCCACGTTTGAACTACTCATCAAACAGATTGATCCGACGGTCTACGTACATGCGTTATCGGACGAGCCGACAGAAT
GGCTATCCAGACCATCATCGTCGAGGTCAGCGTCGGCATCGACTCCATCGCCCCATACATCTTCTTTTGCGTACCAACAACGTAAGGTAAGCTCATTAAT
GAAGTCGTGAGAGTAAGCAGTGAGAGTAAGCAACGTACCTGGACTGGATTGCTTTCCCCCTGTGCTTGAGCTGTGCTCATCTGCGGCATCTTCATTGCCT
GTCTGAGGCGTCTGAACTGGGGACCCGAGAAGGGGGGATTGCTCATGATCGGAGTCATCTCCGTCCATGACAGCATCCTCGTTGCCTGTTTGGGGTGTCT
GAGCTGGGGACCCAAGAGGCGAAGATTGCCCATGGCTACCTCTATCATCTTCGATAGCACCATTTTCAGAGTTGGCATGCTTGTTGGCATTCTCTGAAAG
CGCATTGATATGCGCATCATCAGCGGTGGAGCTAGCACCAGCTTCGTAGTCAATCGCGTGATCGTGCTGCTTCGACTCTTGTTCATCGGTCACCCCCACG
GGCGTGCCTAATTTCACTGTCGGGGTAGATCCAGTGCTATCATCATTAGAAACCGCGCTTTCGTCCTGCTCCGTTTCTTGCTCGGACCTCAGCGCCATAG
ACGGTATAATATCTGGTGCCACATGTATCAAAACGAGATTCTCGAAGCCATCCAACGTGTCGAAACCTGCCCCACCATAAAAATGACACACAATTGATGA
TTAAGTTAAGACAGATTGGAAGTCGGCAAGAAAGCTCAAACATCGGGGTTGCGTACGTTTTTCAAACTGGGTAAGGATATACTGGGCATCTGCGAACAAG
TCTTGAAATGTGACGCCTGCACGGAAATCCCATGGTTAGCTCCGCACTAGTCACACAATTCAAGGATGCAAGTTTCTTTTCGAACCTGGTGTTAGGCTTG
CAATTTTGGTGAAGAATGCAACCAAATTGTTGGTTCGGTACAATTCGATAGAATGTTGCATGCATCGAAGCACGTTATGTACCACCTCCTCAGTCCATTG
GCACTGCTCTGCCACATCCCGGACAAATGCCGCATAGTCAGTTGCGGCCAAGGTACTACTCGGTGCTCTTTTAGAAGCTGATTGTGGCGATATACCAACC
GCCCGCTCGCTTCGTAAGTTGTTTGGATGAGTAGCCCTGGAAGCAGGATTGGCTGCTGCGATGGAAGCACCACTTTGTGCAGGCATATCCACAGTCACCT
TACGAGCTGCTATCGTTGTTGAACGAAGCTTGGGCCGTGGGGCCCAGATACTTTTGCCTTTTCGCTTTTTATTGCGCACAGACAAAATACGGAGGCCTGT
AAAACATCAATCAAAGGTCTTCGTCAGCGAAATAAACTCTTGCGCTCACTTAAGAGACGATTCTATAACGTACACCGTGACTTGATCGCAAAATATCCAA
GCGCGTAGGGATCGTTGTTGTCATTCCAATCTAATCCCAACACAAACATGGCAAAAAAGTTAAAAACAACCGGGCTTCTAAGCGCTTGAAAAAGTAGACA
GCGAAGAGTCTGAGAGTTTTACCTGCGTTAAAGATCTTGTACGCTTCTGACGTCGGATCAAACACAATGCCCGGCAAATCTAAGATTTTGCAACGAGCCC
AAGTCAGGTTACATCATCAAAAGCAAAACCCAGTAAAACGCATGTGCGTACTTGCTGCGCGAACCGATGTTGACTTTTTCAAAAATTTCTCCCGCATGTC
AGCTAGTTTGTTCATGCATGACCCGTCCGTTCGGTCTGACGCAAGGGAAAATATACAATGTCAGCGGCTATCAACATGATGAAACTGCACTGATACACTT
ACGCAGCGATTCGGCGACTTCGTTCACGAGGTCCGAGCTCCCATTCCTCTGGATCTCACTCGTGATCCGAACGAGGAAGTCAACAAGCGTCTCCATTTCT
TCGGATGACCATAGTTTTGGAGCCTTACTGGGTGCTACAAGCTTTTCCTCTCGGCGAGCCGGGGTACCTCGGAAAATATCTCTTTCAAAAGTTCAAGGCG
TGCGATCTCCACTCTCGTTCGCTCTTCACAGAAGCACGACCACATCCACAGATTTATCAGTCACGGTGGACGTCGAATCTGATAACCTGGAGTATCGCAC
TTACGACGTGAACGACGCTTCTCCCTGATGTACAACTCACGCAGCGTGTAGAACTTGCTCTTTGACTCAGCAACCGATTTGCCTGTACATTTCCGCCAGT
GCAACCAGTCACAATTTAAAGCCCGTTTGCAGTCCACGACATGCATGAAACACTCACCCCACAATTGAACCCGCTTGAAATACACCTCCTGGGAACGAGA
AAATAGTTCTCGATACTGCTTGGCCTTCTGGAGGAAGCGACTAAGCTCGTCGGGCAGCCACACACCGCCAGACCTGTTTTCCAGTAGCTGACTAATCGAC
TCGTAGATGTGCTCGTACACATACACTCGTGCCCATTCGTCGCGATAACTGCTCCACACGTCACACAGAATCCCAACCAATGAGTCACCTCAACCAACAG
CGCCCATTGCTCTCTCTTCGCCGCCGTGTACCTTCTGTCCGGAAGTTCTTGGTGCTCAGCACGAGGCCGAATTGCAGCATCAGTGACCGCACCATCTCCT
GGATCTCGACTGTTTTTACCTGCATTGCAAGACACACAAGTCAGCCTCAAGCCCCCATTATTGACGATACCAGTACACGATCTCCAATATGTTCGTTGAT
CGCTCGTTCTTGACGCACCGGGCAGCTCTGCGCGCACGACCTGTGCGAACTCGGCGTCGGACGCGTATACGTAGTGCAGCAGGTGCTTGCGGAAGAGCGA
CAGCAGCGCCAGGACATCGGTGTTGCCCCATCCGGGCACCCGCATCCTAGGCTTGAAAGTCCCGTTAGCTGAAGTTGATGGGAGCTGACCAGGATAGGTG
CCGAATCTGATAGTTGTAATATGAATGTTGCACGAGTGTAAATATGTTATGTACGCACACACCAAGGGGGACTTTTTAAACTGTTTAGTGGGAAATTGGT
CCAGAGCGAGCCATGTCGGACGCTGAGGACGAGCCGAGCAACCAGCGCGCGCTGCTGATCCCCGTCAAGAACTCGGAGCAAGCGGTGGAGGTGTATGTGG
ACGAGCTTCCGGATGACGTCAATGACATCATCGACATCCTGCGCGCAGAGGTGGCGCCGCTCGACGTTTGGCTGCAGTTCGCCGTACGTCCGCGTTTGAT
GAGACCAAACGCGGGATCAACTTTTGACAAATTGTGATTTGTGATAGGTGGAGTACTATAACCAGGGCCATGTTGCCCAGTTCCAGGAGATCCTGGCCGT
GGCGTCCGAGCCAGGCATCGAGGAGATCTATAAAGACAATGCGTCGCGCTTGTGCCGCATCAAGTTTTTCGTCGCGTTGGCCAGCCACGCGGTCAACGCC
ATGTGGAACGAGGAGGACGAGAAAAAACGCGAGGCTATCTCCCAGCGCGCCGTGGGCTACTTCCAGCGAGCCGACCGCCTGGACCACCAGCATCCCATGA
CGCTCGTGGGCAAGGCGCTAATGTTTATGGCCAAGAACGAGGACGATCGCGCGGACCGCTTCGTCAAAAGTGTGCTCATCTCCAACAAGACCAACCTGCC
GGCTATCTTGGGCAAGGCGCTGTTGCTGTACCGCAAGAAGCAGTACAAGGATGCCAAGAAGCTCTATCTGGATGCAATCAAGCTGCACCCGCGCAGCCCC
CAGGCAGCAAACATGCGCATGTGCTTTGCGTACTGCTGCTACCATTTGGGAGCTGTGGAGAAGGCGCGCGCGGTGATGCGTTCACTGCATCGCTCGACGA
GACCAACGTGGACGCAGTGATTGCTAGCGCATTGTGGCAACTTGCGAGTCAGAGCCGCGAGGAGCGTGCCGTCAGCATCCGCGATGAAAGCTCGCGTTTC
ATGATGATGATCCACCACGCCCACGCTATCGACAAGACGAACCCGACGGTTCTGAACCACCTGGCTAACCATTATTTCTCGCAGTGGATCCCGCTTCCTT
GCACGGTGAGCGTGGTGCGTGGATCGGCAGTTGTGGCCACATCCAAGGATATTTCCAATGAAGTCTCGCCAGGTCAGATTATTTGCATCGGTGACAGGTA
CGTTGCCTACATCAGCCGCAACGAAGATGCCGTGTCGCCGTCTGGGTTAAAGCTGGATGGCCCGTATCGCGAAGAGTCCGCGAGCGCTACGAATATTGCA
CGAAAGGATTACGATAAAATGTTCACGCTTGCAGGAAATGCTTTCCACAGTACCAAAATTCCGGAGATCCGCTCTGAAAGCTGCTACCTCATGGGACGTG
GCTGCCATGCCCAGGGCAAGTACAAGGACGCTTACAGCTACTACTTCAATGCTGGACGACTTTGGCCCAAGTTTGTGCTTCCGTGGTTTGGTCTGGCACA
GATGTACTACGAGCGGAAGGAATTCACGAAGGCTGCGTCTTACTTGGAAAAGGCTAACAAAGCGTATCCTGAAAACGTGGAAATCCTGTCCCTTCTTGGC
GATGTGTACGGCAAGCTCGGCAAAAAGGACGAGGCCGTTGTTCTACTTCGTCGTGTCGTAGAACTCGAGCCGGGCAATGTGGAGGCACTGATCGGCACGG
CTGAGCTTTTGCACGGTTCTCCTGAACGAAAAGACCAGATTATCGCGATTTCATCGTACATTGCAGCGGAGAAGGTCATGAACAATGCCTCGGAGCGCGT
ACCTATGGAAGTTTATGTCAACCTGGGTGTACTTCAGCAGCGCGTTGGAAAAATGGCTGATGCCATTGACTGCTTCAAGAAGGCGCTCAAACAACTGGGA
GATGGCAGTACTGCTGACCAAGAGAGCAAATCGGAGGAGGCTGATGCCATTGCCGAGGAAGCCTCAAGTCCCAAGCCAACGGAGGCCAATGTCACAATCC
TGTATAATATGGGACGCGTCTACGAGGAAATGGGCAACCGCGATCGTGCCAAGAAACTCTACGATGGGATCCTAGAGGTGTTCCCCCGCTACACCGACTG
CTTGCTGCGCCTAGGCTGTATGCTGCGTGATCGTGGCCAGGAGGTTGATGCGACGAAGATGTTTGATAAGGTACTGGAGGTGGACCCGGCGTGTGCCGAG
GCCTGCCTGTTGCAGGGCAACATTCACTTGAAGAAGCGCGAGTGGGTGCTTGCTCAGAAGAAATTCGAAAAAGTGATGGGAATGCCCGGATTGAAGAATG
ACCCGTATGCGTTTTTGTCCATGGGCAACATCTTCATGAGCAATCTCGGTGAAAAGAATCGCTACACCAAGAATATGTCGCTGAGTGAAGTATACTACAA
GAAAACGTTGGCGTCACACCCGCACAACATCTACGCTGCCAACGGACTCGGTATTATGATTGCCGAGAAGGGCAACTTCGAGCTAGCAAAACAGATTTTC
TCGCAAGTGCGCGAGGCCAGTCCGGACATGCCAGATGCTTGGATTAATCTTGCGCACATTTTCGTCGCCGAAGAGCGTTACCAAGAGGCCATTCAGCTCT
ACACCGTGTGCCTTACCAAGTGCTACAAAGGACAGGACCTTGAGGTACTGTTGTACCTTGCGAAGGCCTTTTACGAGTCAAAGGACTTCCCGAGCTGTAT
TTCGACGCTATCACGTGCACTGCACATGTATCCGAATGATTTGCGTCTTTGGTACAACACGGGCCTTGCACAGGAAGACTACGCCGTGACGACACTTGGA
CAGGAGACGACTAGCACGCGGTCAGGCAGTGGCAATGCAGTACCCCAACAGCGTACAATGGGTGATGTGCAGCGTGCCATCTTGGATTTGAAGCGAGCGC
AGCGTATCTTCCGCTTCCTGCTTCAACAAGCTGAGGTTACCGGCAATAGCGGCTCTAGTGAAAAAAAGAAACACCACAACAGTTTGCCCTTCGACAAGGA
GAAGGTGTCGGAACACGAGAATTTCTGTGGCGACACCTTGACAAAGGCTAGCTATCACTTGGAATTCGAGCGACAAAAAGAGGAGAAGCGTCGGCTGGAG
ATCGAGGCTCAACGCAAGCTGCTGCGCGAGTACGAGGAGCGTGTGGCACGTGAGCAGGAGGAAACTCGCGTAAAGGAAGACGACTTGCGCAAGCGCCACG
AAGGCATCCGCCTCAAGCAGGACGAACGTTTGAAGAAATTGCACGAAGGCTGGAGTGTGCGTGAGCGCGAGGAGGAAGAGAAAGAGAAGAAGGTTGTCAA
AAAGAAAGGAGGCAAGAAGCGCAAAAAAACCGAGGACGAGGACGGCGGCTTCATTGACGACGCAGAGGACGAATTGGATGAGGACGGCGATAACAGCATG
TCGATCGAGGACATGAAGAACCGCAACGCGACCATGAAGAAGCTGGTGGAGAAGCGCAATAAGCGTGCGCGTGTGGGGTCTGGCTCGGAAGACGAGAAGG
ATGACCCCACCGGACTCTTTGGCTCTGACTCAAGTGACGATGAACAGGAATCCAAACCAAGCGACACAATCAAGGATGATGACAAGCCTGCTGCAGAAGA
TGATGCGGCAGAGGATAGTCGTGAAGCTGAGAACGAACTGTTCGGCTCTTCCTCTGATGATGAGTAAGTTGCCGGATTCAGGAAGGAGGACAGTATCGAC
TGCGGGCCGTGCGCTACTAGTTTTCTTCATAAAACTTTTCTGATTGGCCTTGTCGTTGATTTCTCAAAGCTTTTTTTTTACGCTCACCGAAACTTGGACT
TTATATTAATTTTTGGCAATTTTTGGGAGTCGACTTGGCGCCAAAACGGATTTGCAACAACCAAATTTCCCGGGTTTTGATTGGCTGGGAGCGGACGTCG
AGGACGAATGATGATCACATCGGCCGGACAAGTCTCCCGCGCTTTTTTCCGCCAGCGTGGCTCGTTGGCGCGCGGCGAGCAAGTCGAGCTCTTCTGCTTG
TCATTTTGGCTTTGGCGCTCTACTCCTCAAGCGACTCCTCCAGCTCCACCGCGCAGTCGCTCAGCTTCTTCTTGCACCAAGCAAGCAAGCAGCTACCCAA
CCCGTCCAGATAGAATGGTCGCTGCCTCGTTGGAACGCGCTGCCGCAGACAAGTCGCCGGAGCAGCCGGAGCAGGAGCTGAGCCCGCAGTTCGTGGAGGG
TTTCGCCAAGGTAACAATGGAGAAGAAGGAGGAGCCGAAGCTCGAGATGTCCGAGTACAAGTTGAAGGAGGTGAACGGCGAGCTGCAGCCGGAGCCGTTC
CTGTGGAGAACCCGAACCGATTCGTGCTGTTCCCGATCCAGGAGCACGACGTGTGGCAGATGTACAAGAAGGCGGAGGCGTCGTTCTGGACGGCCGAGGA
GCTGGACCTGGTGCACGACCTGAAGGACTGG