Description :
From Genome Similarity Track
Location :
Scaffold_983:3359- 6535
Transcript NameFunction/comments
Physo_126293putative polyprotein

Sequence
3176 bases(100 bases per row)
NNNNNNNNNNNNGACGACTTCACTCGCTGACACGTCTCACACGTGCGCACATAAGTGCTCGTCCACTTGTACATCTTCGGCCACCAGTAGTGGGTGCTCA
CCGAGCTGTAGGTCTTCTCACGGCCAAGATGGCCGGCCTGCGGCGTGTCGTGTACCTCATAGAGGATGCAATACTTCAGATCCTCATCATGAGGGATGAC
CACGCGGGGAGTATCCATCGGGCCGGTGTTGTAGAACAACAGTCCTCCATCGAGGGAATAACGGTGTAGCCGCGCGCGCAGCCGCGCTGACAATTCCATG
TCCGAGTCTTGAAACTCCTTGCTCCCCAGAGCCTTCAGCAACGCGACACAGGTGTCGTCCTTGGCATAAGCCGTTCGGATCAAATCCGGTAATGACGAAG
TCACGGTCGTTACATGAGCCAGCTCATAATCCGGCCTGCGCGACAGCGCGTCCGCAAGGACATTCTGCCTGCCAGGCTTGTACTTCACCTCGAAGTTGTA
CTCCACGAAGAAGGACAGCCAGCGAGCCATCCTTTACGAGAGATGAGACGACTGAGTCGCAGTGCGTAACGACGCATGATCCGTGTAAATCACGAACGTC
TGAGAGCCCAACAGGTGCACCCTGAACGTGACGAGCGCATACTTCATCGCAAGTAGCTCTTTGTCATGGACAGGATAGTTCATCTCCGCAGCCTTTTGTG
GTGTAGTGCCTAGAGAGGAAGCGGGCACGTCGGCGTCGGTGAAAGAAGGCGCCGAGACGAATGCTGATGGATGCGGATGATGAACTCGACGCAGTTGATG
AAACGCGACGCGATTGATGGGGGCGACGCGCGGCAGAGGTCGACGGAAAGTCGACGCGGGTGATGGGCCGCGAGACACAGCGACAGAGTCCAACTCGACG
CGTAATCATCCGACGAGTCGACCAGCGCCCCGTCTCTGCAAAACGCGTCGACCCTAATCCCCGCCGAGCAAGACGCGCCGAGTAAGACGCGCCGACCAAA
ACGCGTCGAGGTAAGATCTTGATTACGCCACGCAAATCAGGTTGAAGGACGGCAGTGCAAGCACGACAGAAGTAGGGATAGGCACAGAACGATCGGCTTA
GCAAGCAGTAGTACGGAGTAGCCAGTAGCTAGGGCATAGGATAGGGTAAGGACTCAGTCCCGAAATTTCTCTGAACCACAAAGACCTCCCGTCTTCTCCG
AGGTTCCAGGGGAGCCACCAAGCGCCGGCAAGTAGAGCCGCCTCGATATCGCGGCCCCCCGTCGTTTGCTGGTTCGGGTGCTCACCCCCCCACAGACCCG
TGCTGGAACAAGGCACGTTGAACGTATACCGTTTAGGTGGGCGCCCCGATACGCGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNATACACTAGCGTCGCTCTCGTAGGTGCAGTACCGACCGCGAGAACTGGTCACGGCCTTGTACTCCTTGAACGCC