Description :
From Genome Similarity Track
Location :
Scaffold_163:33587- 35715
Sequence
2128 bases(100 bases per row)
CGTGCTCGACTACAGCAACGCGTACTTCGGCGACGACAAGTGCGCCGAAATCGTCGAGGCGGTGCGGCGAGCGCCATTCCCGACGGCGCTGGACCTGCGC
GGCAATCGCTTCGAGGCCGCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAGCATAACGTCGTGTCGATCAGTCTGGAATGGAACAATGTGG
GCGTGTTAGACGAAGGCATTGAGGCGATCGCAGCGGCGCTGGAGGTCGACACGCGTCTCATGACGCTAGATCTGCGGAACAACAACATTAGCGCCGAGGG
CGCCAAGGCACTAGCACAGGCACTAGTGCGAAACCGCACGTTGAAGCAACTGGATTTGCGTTGGAACGATATTGGGAATGCCGGCGTGTTGGCATTCCGT
GAAGCGCTACAGAGTAATCACTCGCTGCTCAACTTGGAGCTCATGGGCAACAACAGCAGCTTGAAGCACGCTGACGAGATCGAGAAACTTCTCGTGCGCA
ATCGCACATTTCAAGAACAGCAACAGCAACCACCATCAATGGAAACTGTGCAAGACGTACCCAATACAGTGGCAGTGGAAACGAAGCAGGACGACCAGCT
TTTGCTGCAGATCCTCGCGGAGAAGGAGAACCTCGAGTCCGAACTGTTCCTGGCAAGGAAAGAGATTCACAAAATGGTACGTGCCACCAATGTTGTTGTC
TCCCATTGGTCTGTTTGTTAGAAATTATTATCTTTGTGAGTGTATTGTCAATTTTTGTAGAAGGAAACGCTTGAAGAGAACGACATGCACCTCAAGATGC
TGCGCAAAGAAGCTGAAACTTTGAAAGAGGACCGCAATCGCTACCAGCAGCGTGAGATCGATGCCAAGCGCGAGACACATGAGCTCAAAATGCAGTTTGA
GGAACTGGAAAACAAGCGCAAGATTGAGTTCGAAGAGTACCGTGCAACGCGGACGGCGTTGGAGCGCGACATCAGCGTCATACGCGACAAGATGAGCCAT
TCAGAGGCGCTGCAAAACAAGGCGTTGGAGCAGAAAAACAAGCACATCGCGCAACTTGAAGACCAAAAGTACATTCAAGACAACGAGATGCACAAACTGA
GCCTCACCACGCGGTACGATTCCTTCATGATATGAACTGGGTAATCACTTTGTAGTGCTTCTAACGTCTCTCTCTGTGATAGATCTCTCGAAGAAGATGT
GGAGCGACTGCGCAAGCAATTGCAAGACGCGCAAAAAGACTTCAGCAAGAAGGAAGACGCCTGGATCACATCGCAGCAAAGCACGCTGGCTACGATGCAT
CGCCAGTACGAACTGGAAGTTCAGGCTCTCGAGAGCCAACTCAGCCATGCGAATCGTCAGCTCGAAGACAGTCAGCGAACAGCGACGACGCTCAAGGAAA
AAGCAGAGACGCTGCAGGCGATGAGTCTTCAGGCCAAGATCGCCCACGAAAAGGAGATCAGCGCATTGAAAGCGCAGTGGGAAATCGAGCTCCAAGAGCG
AATTCAGCGTGCCGTTGGCTCGATCGAGGCTCAGGTGGAGGACGTGAAGCAGGGCCGATTGCACCTCGAGCGAGAGGTCGAAAAGCACATGGACACTATC
TTGCGGTTGCGTCAAGAGAACCTCGTGATTCAGAAAGCGAGCGATGAGAAACACGCGAACTTGCACAAGGAGCTCGAGAAACAGTACAAAGAGCTCCAGG
AGAAGCAGGATTTGTGCGCAGCTGTCACAAAAGACAAGACGCGATGCGAAGAGAAGCTGCAAGCGCACCTTCGGAAACTCGAAGAGCAAGACGCTCGATT
TGTGCGCATGAAAGAAGGCTACGACGAGCGTATCCAGGTACGTTGTGCCAGGCTGTTTTATGGTTTTATGGAGGCAACGGCCCGTGCTCATGCTTCAGTC
TGTAAACGATGTAGGAAATGACGAAGACAGCAGAAGCCCACCGTCAGGAAATGGAAGCTACGCTAAACACAAAAGTGAATGTAATCACAACGCTGGAGAC
ACAGATCCTCCGTCTCGAGCGCGAGCTCTCGGCACAAAACCACGAGCACGAGAAGCGGATCGACGACTTTGCCGAGTCCTTCAGCGTGTTCCTTCAAGAG
CAAGTCGCCAAGGAGCGCGAGCGACGAA