Description :
From Genome Similarity Track
Location :
Scaffold_39:335849- 337349
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011962Similar to Eml5l: Echinoderm microtubule-associated protein-like 5-like (Mus musculus)

Sequence
1500 bases(100 bases per row)
CTGCACAAAGTTCTTCGTCTTTTTGCTCGTCGATTGAAACGTTGTCTGCTTCAGATTGGGCTGCTTCCGGTGGTTCGTCGTCTCGTTCGTTTCGCTCTCG
GTACTGACGCGAATGCTGCCGAGGTGATCTCTGGTTGGAGTTGGTCCTCTCAGTCGCTGGTGGAGGAACGGGACTTGTGTTCCCGACGCTAGTGCTGTCA
AACTCGTCTCCGAAACCTCTTTGCTGTCGTTTTCGGGCAACCGGTGACAGTTTGCTGGGACCCCTTCTTGTTGAACTCACATTACCTTGTGTCAATCTCC
ATTGGATTATCGTTGCATCTTCGCCACCGACTGTGATCAAGTATTTGTCATTGAACGAGAAGCAAAGCGACGGAATCGTTGCTGCGTGAGCCAAGTAGTT
GCGAAACTTTGCACTTCGCATTGCTGGCCACTTGAACAACCGTACACTTGATTTGCATGCAACAGCGATCAGGTCTTCCATATTATCCGAGCTTGATGGT
ACGCTCGTGACAAAAGGATTGCTTGAGCCATCATTGTCACAACTCTCACGGCTGCTGCTGTTCGACTTCGGTCCTGTTGTGCACACTGCAGCAATATCGA
CGAGGCTCGTGGTATCCTCGGACCAAATGCCTGGAGTTGGCCATCCAAACGCACACGTCCATTTGACCCACTGCGCGTCTCGGACGAGAAACGCGTCCGT
GATCTGCTTCGTGTTGGTTTTGGAGTGCGAAATGGACCAATACAACAACTCGCCGTCGGACGCATTGCTTTGTAGCAAATCACCCTCTGCGCTCCAGGTC
AACTGGGTGATCGCGCTCGAGTGGCCCTCGCACACGTGCATGCGCTTGTAGTTGTTGCCGATGTCGTACAGGTACACAAACGTGTCTTTTGCGCCGACGG
CCAAAAAGTTGCCCTTTGGACAGTATTTTAGCTGTGAAATGCTTGTTCCACCACCAGGACCTCCTTGTCCACTGAAAACACCTGAGTGCAGTTCCACAGT
ACTGGAACTCCCTGCATGGGGCTTAATCGTTTTCTTCACCATCAGTTTCAGTTCGTGATATCCGATTATCGCGAGCTCGCCATTTGTCATCCCGATCGCG
AGCTCGTCACCAAACGGCTGGAAGTCCATGCAAGCAGCTCTCACACTATTTGAAGTATGACTTCCGAGGTGCATCCTCCGTTTGCAGCAATGGCGCTTCA
AGTCCCAAATGCATACGTATCCATCGAGGGACACGGTCACGACTTCTTCTTTCCCTGGATGGCAACTGCATGCGACCACGGCACCACTTCGCGCTTCAAA
GACCAGTTTCCACTCGCCTGTCGTGATGTTGATCTCCCAGAGACAGTTGGAGCTCGTGCCTACGAGTGCAAATTTGCCGTCGTCCTTCCATTGCAGACTC
GTCGGCTTTGCCGTGATGCCGCTGTTGTTTTCTCCTGGAACCGTGGTGGGCAGCTGAAATACGAGAGTATCCTGGTCAACCGGCATTAATTGATGCGATC