Description :
From Genome Similarity Track
Location :
scaffold_38:335777- 345154
Transcript NameFunction/comments
g12744.t1 hypothetical protein PHYSODRAFT_353490
g12745.t1hypothetical protein
g12746.t1 conserved hypothetical protein
g12747.t1 RNA polymerase-associated protein CTR9

Sequence
9377 bases(100 bases per row)
ATGGGAAGAAGCACGCAGCGCCATTCGCGCCTAACTCGAACAAAAAATGTATCCATCTGACGTACGTGACCTTAATTAGGAAATCATCTGTGACAGAAAT
GCGTCAAGTCAAGTCGCTGGTGGAGCTGTCGGTGGTGGCTGCGGCGCTCTCCACGCCCGTACAGGAGCTCCTGGACTATGTGGAGCTCCTGCCCATCGCC
ATCCGCCACCAGCTCTTCCGAGAGTTGCCCAACTTCCGACTGCGCGAGATGGAGGTGGCGTGGGAGGCGTCTGTCCAGCTGGGGGAGGCCCCGGAACCGC
GCGACGGCTTCGACCCCCAGGCGGGTGACAAGTTCCTGTTTGACCGAGAGACGCAAGGAGTGTGGGAGCTCCGCATGAACGCAGCAAGACTGGGCTACGA
GCCGATCCCCATCGAGAACACGGCGGCGGCCCAAGGACGCAGACGCAACCACCGGCACATCTTCTGGGAGCACCAGTTCCGCACGTTGCTCAAGCTGCGC
ACGCCACTCGATTTTGCAGGGCCTGTCGACGTGCTCACAGAATGCCAGAAGCTCTTTGTGGACGTCGTGGAGGTGCTGAAAGTGCACGGCCGAGAGGTCT
GTAAGGATAATGTGGGGCTGGTCTTGGCGCTTCGACGGCTGCGACGACTGGAAGTGCATCATCCGGAACAGCAAAATACGTCCTGGGAGTCCATGGGGAA
GTTGATGCAGGACCACCCACATCTTACTGAACTGGGGTTCTTCCACGGCAAGTTGAGTGATAACCAGATCGTGCATATCCGCAAGACGCTGGCGAATCCG
AACCTGACGGTGGACAAAAGTCTGAACTGCAGCAGAATCACGACGCTGGAGTTTGTCTCGGTGAAAATTCGACCTGAAGGGTATCGCCAATTGGTGGCCC
TGGTGATTGACATGACGCAGCTAACCAAGCTTAGATTGAGCAACACTATCACGGATTTCGACACGAAGCTGCTTGTCGACGCAGCACTGCGTGCCCCGAA
GCTGGAACAACTGTTTCTGGAGCACAATGAGCTGGAAGATGATGCATTCTTGGGGCTTGCAAAACTGCGAAAACCACTGGCACTGCGACACCTTCGCCTC
AGCGATAATGACGTGTCGCCTATAACGCTGGGGGCGATCTGCAGCGCCAGTATGGATGGCGTACTGAATCTGGAGAGACTTGAACTTACCAACAACGTGC
AGATTGGCGATCCGGGTATACACGCACTAACACCGATGCTGGCTTCCCCAAGCGCTGGACCTGTAGCGGTACTTACGCATCTAGACGTTCGCGGCTGCAA
TTTTGGCCTCGAAGGGGTGACCGCCTTGCTGCTAGCGCTGGGGCGCAACAAGACGGTCAAACACTTGAACCTCGCACAAAACTTTTTCGATGTTGGATTT
GGCGACGTGCTCGCCGATTTTCTGGTCACCAACGACTCGGTCACAAATCTGCAAGCGAATGGCGTTGGATTGGGTTTGGCAGGTGTGTCTGCTCGGCTGT
TGACAGCATTAGAGAAAAATACCATACTCACATCACTATCGTTAGGAGCGAATCGACTTCGAAATGATGGTGCGTCTGCGCTGCTGCGAGCACTCGTAAA
GCGTGCTGAAACAAAGCCTTTCACGCTGGTTGACTTGAGTGGAAATCTTCTCACGTTGAGTGGGCTTGCGATGCTCACTGATATTTTGGAGATCCCTGCT
AGTGCGGATCATGCTCGCCCCGGTTACGCTAGCAGGAGTTGTATTGACGGGCAAGGACAGGAAGTTTTGGCAGATCGTAAACGACGGCGTATCGGTAGCT
TCGACTACCACAACTTGTCGAGTCCGCTTAACAAGCCAATCGAAGAGCTATGCTTGCTGAATAACGATTTCATCGGAATCGATGACGAGTACGCGGGTGA
CAGCTCGACACTAATAGAATCCATCCGTCGCCGCGTAGGGCACCTGAAGAGTAACGAGTGGGCAATACAGCACCAAGTCTACGACGACGAAGTGTAAAGC
AAATACACATATTCCGGCACTCAATATGTAAAATTCCTGAGGAGCTTCTCACACCACTCAATGAAAGGGTGTGTTCCTCATTGCATCAATAACCCACCTA
ACTACACAAAGTAGGATAAGAGAAATCCAAAGGTTCCTCCGAACCATCGACGTCGACCGTGCAGCACGAAGCATCAAAATTCACACCACGGCAATGCCAC
TGAGACTGTTCTTTGACGCTGCCACCTACCTCTCGAAGGATAACGACTGCATACTCGGATAGATTCCGAATTCGCGGTCAGTGCACTGAAGCTCGCGCCA
TTCACGACCTTCCTTTCGCTTGATGAGTTGGCTCTGTTTCTCTCGTAGCTCCACGATCTGCGAATTGTAAGAGTCCAGTATGTCTTGCAATGGATGAGGA
GGTTCATCCTGCTCTCCATCCGAGCTAGTGTTATCAATATCGTCCGGCACCTCAACGTCTTCGTTTAAGTCATCATCATCATCATCGTCGTCGTCGTCAT
CCTCTCCTTCGTCGTAACCTTCATCTTCTCCGATTTCGTCTTCCTCTTCATCATTGGCTTGGGAATTCTCCTCGTCCAGGCGGCGCTTCTTTGCCAAATC
AAATCTCTTTCCATATTGTTCATCCTTGCCCCGCTTGGATGGTTTCTTTGAGCTATCAGAAGTAAATTGTCGTACAAGCGGATACGGATTGTTATTGTCT
TTGGAATAGTGGCCACCCTTCGCATCAGATATATTGCTTGACCCCGACCCTGCAAAGGGAAAACGCACAAGATTCGTGAGATACTCCAAGAGATAGCCAC
GTTTGAACTACTCATCAAACAGATTGATCCGACGGTCTACGTACATGCGTTATCGGACGAGCCGACAGAATGGCTATCCAGACCATCATCGTCGAGGTCA
GCGTCGGCATCGACTCCATCGCCCCATACATCTTCTTTTGCGTACCAACAACGTAAGGTAAGCTCATTAATGAAGTCGTGAGAGTAAGCAGTGAGAGTAA
GCAACGTACCTGGACTGGATTGCTTTCCCCCTGTGCTTGAGCTGTGCTCATCTGCGGCATCTTCATTGCCTGTCTGAGGCGTCTGAACTGGGGACCCGAG
AAGGGGGGATTGCTCATGATCGGAGTCATCTCCGTCCATGACAGCATCCTCGTTGCCTGTTTGGGGTGTCTGAGCTGGGGACCCAAGAGGCGAAGATTGC
CCATGGCTACCTCTATCATCTTCGATAGCACCATTTTCAGAGTTGGCATGCTTGTTGGCATTCTCTGAAAGCGCATTGATATGCGCATCATCAGCGGTGG
AGCTAGCACCAGCTTCGTAGTCAATCGCGTGATCGTGCTGCTTCGACTCTTGTTCATCGGTCACCCCCACGGGCGTGCCTAAATTCACTGTCGGGGTAGA
TCCAGTGCTATCATCATTAGAAACCGCGCTTTCGTCCTGCTTCGTTTCTTGCTCGGACCTCAGCGCCATAGACGGTATAATATCTGGTGCCACATGTATC
AAAACGAGATTCTCGAAGCCATCCAACGTGTCGAAACCTGCCCCACCATAAAAATGACACACAATTGATGATTAAGTTAAGACAGATTGGAAGTCGGCAA
GAAAGCTCAAACATCGGGGTTGCGTACGTTTTTCAAACTGGGTAAGGATATACTGGGCATCTGCGAACAAGTCTTGAAATGTGACGCCTGCACGGAAATC
CCATGGTTAGCTCCGCACTAGTCACACAATTCAAGGATGCAAGTTTCTTTTCGAACCTGGTGTTAGGCTTGCAATTTTGGTGAAGAATGCAACCAAATTG
TTGGTTCGGTACAATTCGATAGAATGTTGCATGCATCGAAGCACGTTATGTACCACCTCCTCAGTCCATTGGCACTGCTCTGCCACATCCCGGACAAATG
CCGCATAGTCAGTTGCGGCCAAGGTACTACTCGGTGCTCTTTTAGAAGCTGATTGTGGCGATATACCAACTGCCCGCTCGCTTCGTAAGTTGTTTGGATG
AGTAGCCCTGGAAGCAGGATTGGCTGCTGCGATGGAAGCACCACTTTGTGCAGGCATATCCACAGTCACCTTACGAGCTGCTATCGTTGTTGAACGAAGC
TTGGGCCGTGGGGCCCAGATACTTTTGCCTTTTCGCTTTTTATTGCGCACAGACAAAATACGGAGGCCTGTAAAACATCAATCAAAGGTCTTCGTCAGCG
AAATAAACTCTTGCGCTCACTTAAGAGACGATTCTATAACGTACACCGTGACTTGATCGCAAAATATCCAAGCGCGTAGGGATCGTTGTTGTCATTCCAA
TCTAATCCCAACACAAACATGGCAAAAAAAGTTAAAAACAACCGGGCTTCTAAGCGCTTGAAAAAGTAGACAGCGAAGAGTCTGAGAGTTTTACCTGCGT
TAAAGATCTTGTACGCTTCTGACGTCGGATCAAACACAATGCCCGGCAAATCTAAGATTTTGCAACGAGCCCAAGTCAGGTTACATCATCAAAAGCAAAA
CCCAGTAAAACGCATGTGCGTACTTGCTGCGCGAACCGATGTTGACTTTTTCAAAAATTTCTCCCGCATGTCAGCTAGTTTGTTCATGCATGACCCGTCC
GTTCGGTCTGACGCAAGGGAAAATATACAATGTCAGCGGCTATCAACATGATGAAACTGCACTGATACACTTACGCAGCGATTCGGCGACTTCGTTCACG
AGGTCCGAGCTCCCATTCCTCTGGATCTCACTCGTGATCCGAACGAGGAAGTCAACAAGCGTCTCCATTTCTTCGGATGACCATAGTTTTGGAGCCTTAC
TGGGTGCTACAAGCTTTTCCTCTCGGCGAGCCGGGGGTACCTCGGAAAATATCTCTTTCAAAAGTTCAAGGCGTGCGATCTCCACTCTCGTTCGCTCTTC
ACAGAAGCACGACCACATCCACAGATTTATCAGTCACGGTGGACGTCGAATCTGATAACCTGGAGTATCGCACTTACGACGTGAACGACGCTTCTCCCTG
ATGTACAACTCACGCAGCGTGTAGAACTTGCTCTTTGACTCAGCAACCGATTTGCCTGTACATTTCCGCCAGTGCAACCAGTCACAATTTAAAGCCCGTT
TGCAGTCCACGACATGCATGAAACACTCACCCCACAATTGAACCCGCTTGAAATACACCTCCTGGGAACGAGAAAATAGTTCTCGATACTGCTTGGCCTT
CTGGAGGAAGCGACTAAGCTCGTCGGGCAGCCACACACCGCCAGACCTGTTTTCCAGTAGCTGACTAATCGACTCGTAGATGTGCTCGTACACATACACC
TCGTGCCCATTCGTCGCGATAACTGCTCCACACGTCACACAGAATCCCAACCAATGAGTCACCTCAACCAACAGCGCCCATTGCTCCCTCTTCGCCGCCG
TGTACCTTCTGTCCGGAAGTTCTTGGTGCTCAGCACGAGGCCGAATTGCAGCATCAGTGACCGCACCATCTCCTGGATCTCGACTGCTGTTTTACCTGCA
TTGCAAGACACACAAGTCAGCCTCAAGCCCCCATTATTGACGATACCAGTACACGATCTCCAATATGTTCGTTGATCGCTCGTTCTTGACGCACCGGGCA
GCTCTGCGCGCACGACCTGTGCGAACTCGGCGTCGGACGCGTATACGTAGTGCAGCAGGTGCTTGCGGAAGAGCGACAGCAGCGCCAGGACATCGGTGTT
GCCCCATCCGGGCACCCGCATCCTAGGCTTGAAAGTCCCGTTAGCTGAAGTTGATGGGAGCTGACCAGGATAGGTGCCGAATCTGATAGTTGTAATATGA
ATGTTGCACGAGTGTAAATATGTTATGTACGCACACACCAAGGGGGACTTTTTAAACTGTTTAGTGGGAAATTGGTCCAGAGCGAGCCATGTCGGACGCT
GAGGACGAGCCGAGCAACCAGCGCGCGCTGCTGATCCCCGTCAAGAACTCGGAGCAAGCGGTGGAGGTGTATGTGGACGAGCTTCCGGATGACGTCAATG
ACATCATCGACATCCTGCGCGCAGAGGTGGCGCCGCTCGACGTTTGGCTGCAGTTCGCCGTACGTCCGCGTTTGATGAGACCAAACGCGGGATCAACTTT
TGACAAATTGTGATTTGTGATAGGTGGAGTACTATAACCAGGGCCATGTTGCCCAGTTCCAGGAGATCCTGGCCGTGGCGTCCGAGCCAGGCATCGAGGA
GATCTATAAAGACAATGCGTCGCGCTTGTGCCGCATCAAGTTTTTCGTCGCGTTGGCCAGCCACGCGGTCAACGCCATGTGGAACGAGGAGGACGAGAAA
AAACGCGAGGCTATCTCCCAGCGCGCCGTGGGCTACTTCCAGCGAGCCGACCGCCTGGACCACCAGCATCCCATGACGCTCGTGGGCAAGGCGCTAATGT
TTATGGCCAAGAACGAGGACGATCGCGCGGACCGCTTCGTCAAAAGTGTGCTCATCTCCAACAAGACCAACCTGCCGGCTATCTTGGGCAAGGCGCTGTT
GCTGTACCGCAAGAAGCAGTACAAGGATGCCAAGAAGCTCTATCTGGATGCAATCAAGCTGCACCCGCGCAGCCCCCAGGCAGCAAACATGCGCATGTGC
TTTGCGTACTGCTGCTACCATTTGGGAGCTGTGGAGAAGGCGCGCGCGGTGATGCGTTTCACTGCATCGCTCGACGAGACCAACGTGGACGCAGTGATTG
CTAGCGCATTGTGGCAACTTGCGAGTCAGAGCCGCGAGGAGCGTGCCGTCAGCATCCGCGATGAAAGCTCGCGTTTCATGATGATGATCCACCACGCCCA
CGCTATCGACAAGACGAACCCGACGGTTCTGAACCACCTGGCTAACCATTATTTCTCGCAGTGGATCCCGCTTCCTTGCACGGTGAGCGTGGTGCGTGGA
TCGGCAGTTGTGGCCACATCCAAGGATATTTCCAATGAAGTCTCGCCAGGTCAGATTATTTGCATCGGTGACAGGTACGTTGCCTACATCAGCCGCAACG
AAGATGCCGTGTCGCCGTCTGGGTTAAAGCTGGATGGCCCGTATCGCGAAGAGTCCGCGAGCGCTACGAATATTGCACGAAAGGATTACGATAAAATGTT
CACGCTTGCAGGAAATGCTTTCCACAGTACCAAAATTCCGGAGATCCGCTCTGAAAGCTGCTACCTCATGGGACGTGGCTGCCATGCCCAGGGCAAGTAC
AAGGACGCTTACAGCTACTACTTCAATGCTGGACGACTTTGGCCCAAGTTTGTGCTTCCGTGGTTTGGTCTGGCACAGATGTACTACGAGCGGAAGGAAT
TCACGAAGGCTGCGTCTTACTTGGAAAAGGCTAACAAAGCGTATCCTGAAAACGTGGAAATCCTGTCCCTTCTTGGCGATGTGTACGGCAAGCTCGGCAA
AAAGGACGAGGCCGTTGTTCTACTTCGTCGTGTCGTAGAACTCGAGCCGGGCAATGTGGAGGCACTGATCGGCACGGCTGAGCTTTTGCACGGTTCTCCT
GAACGAAAAGACCAGATTATCGCGATTTCATCGTACATTGCAGCGGAGAAGGTCATGAACAATGCCTCGGAGCGCGTACCTATGGAAGTTTATGTCAACC
TGGGTGTACTTCAGCAGCGCGTTGGAAAAATGGCTGATGCCATTGACTGCTTCAAGAAGGCGCTCAAACAACTGGGAGATGGCAGTACTGCTGACCAAGA
GAGCAAATCGGAGGAGGCTGATGCCATTGCCGAGGAAGCCTCAAGTCCCAAGCCAACGGAGGCCAATGTCACAATCCTGTATAATATGGGACGCGTCTAC
GAGGAAATGGGCAACCGCGATCGTGCCAAGAAACTCTACGATGGGATCCTAGAGGTGTTCCCCCGCTACACCGACTGCTTGCTGCGCCTAGGCTGTATGC
TGCGTGATCGTGGCCAGGAGGTTGATGCGACGAAGATGTTTGATAAGGTACTGGAGGTGGACCCGGCGTGTGCCGAGGCCTGCCTGTTGCAGGGCAACAT
TCACTTGAAGAAGCGCGAGTGGGTGCTTGCTCAGAAGAAATTCGAAAAAGTGATGGGAATGCCCGGATTGAAGAATGACCCGTATGCGTTTTTGTCCATG
GGCAACATCTTCATGAGCAATCTCGGTGAAAAGAATCGCTACACCAAGAATATGTCGCTGAGTGAAGTATACTACAAGAAAACGTTGGCGTCACACCCGC
ACAACATCTACGCTGCCAACGGACTCGGTATTATGATTGCCGAGAAGGGCAACTTCGAGCTAGCAAAACAGATTTTCTCGCAAGTGCGCGAGGCCAGTCC
GGACATGCCAGATGCTTGGATTAATCTTGCGCACATTTTCGTCGCCGAAGAGCGTTACCAAGAGGCCATTCAGCTCTACACCGTGTGCCTTACCAAGTGC
TACAAAGGACAGGACCTTGAGGTACTGTTGTACCTTGCGAAGGCCTTTTACGAGTCAAAGGACTTCCCGAGCTGTATTTCGACGCTATCACGTGCACTGC
ACATGTATCCGAATGATTTGCGTCTTTGGTACAACACGGGCCTTGCACAGGAAGACTACGCCGTGACGACACTTGGACAGGAGACGACTAGCACGCGGTC
AGGCAGTGGCAATGCAGTACCCCAACAGCGTACAATGGGTGATGTGCAGCGTGCCATCTTGGATTTGAAGCGAGCGCAGCGTATCTTCCGCTTCCTGCTT
CAACAAGCTGAGGTTACCGGCAATAGCGGCTCTAGTGAAAAAAAGAAACACCACAACAGTTTGCCCTTCGACAAGGAGAAGGTGTCGGAACACGAGAATT
TCTGTGGCGACACCTTGACAAAGGCTAGCTATCACTTGGAATTCGAGCGACAAAAAGAGGAGAAGCGTCGGCTGGAGATCGAGGCTCAACGCAAGCTGCT
GCGCGAGTACGAGGAGCGTGTGGCACGTGAGCAGGAGGAAACTCGCGTAAAGGAAGACGACTTGCGCAAGCGCCACGAAGGCATCCGCCTCAAGCAGGAC
GAACGTTTGAAGAAATTGCACGAAGGCTGGAGTGTGCGTGAGCGCGAGGAGGAAGAGAAAGAGAAGAAGGTTGTCAAAAAGAAAGGAGGCAAGAAGCGCA
AAAAAACCGAGGACGAGGACGGCGGCTTCATTGACGACGCAGAGGACGAATTGGATGAGGACGGCGATAACAGCATGTCGATCGAGGACATGAAGAACCG
CAACGCGACCATGAAGAAGCTGGTGGAGAAGCGCAATAAGCGTGCGCGTGTGGGGTCTGGCTCGGAAGACGAGAAGGATGACCCCACCGGACTCTTTGGC
TCTGACTCAAGTGACGATGAACAGGAATCCAAACCAAGCGACACAATCAAGGATGATGACAAGCCTGCTGCAGAAGA