Description :
From Genome Similarity Track
Location :
Scaffold_51:335769- 355397
Transcript NameFunction/comments
Aphas_H257_13564ubiquitin protein ligase

Sequence
19628 bases(100 bases per row)
TTTGACACGCGTGTGTCGGCGTATCTTCAAAATGTCCAAGCCTTGAATGCCATAACGAAGAAGGAAAAACACAACTACGAGCAACGCCTCGTCGCTGTGC
GGAATGCGACCAAGAGCCAACGCAAGGTGAGTCCGCCGCCGCTGCCGCTGCCCACTCAAAACTGCATGATACTGGGTTGGGACATGGCGATTCAATTGAT
GAAAGCCACTCGGAAGGAAGGCAACGGGGACACATACCTGCACGCGCTCCAGACCATTCAAGAGCACATGTCGACTCTCAAACCACTGGCGTACTTGGAC
GGCATGTACGTTAGTCCGAGCGCAAGCCAGTCGTTCGACCTTCTCTGCGACTTTCTCATCCAAGCCGCAGTGGTCATTCCTGGCCGCGATGTCACGGTTG
AGGAGGAAATCGCGCGGCAGTCCATCTCAGTTCTCTGCGATTTGGCCCTCGCCCGAGGGTCCCTGTCGTACTTGTTGTCGTGTGTGCTATGGATGCTGTC
TAGTCGTACAGAAACGCCTCTGCACTTGAATGCGCTGCTGACCAAAGTTGCTGCGATCAAGGAGCAATCGTTGTACGGGATTTGCGAAGCATCGGGGGAG
CTGTACTGTTGCGGTCAGAACTCGTACGGCGAGCTAGGGGTCGGCGACGACATCGAGCGCCACCAGTTGACGTTTGTCCCATTTGGCGGGTGGGACGACG
TCAAGCAAGTCGTAAGTGGTAACGAGATCCTCGCGATGCTGACCAACAGCGGCGTGGTGCTCACCGCGGGCCTCAACAAGAGCGGACAGTGCGGCCACGG
CCACTTTGACGAGCGCGTGATGCTGCTGCGGCCAGTGGAAGCGCTGCGGTCCCAGAAGGTCACGTACATCGCCGCGAGCAACGGCTGCGAGCACATGATC
GCCGTCACGGACACGGGGCTCGCGTATTCGTGGGGGTACAACGACCGCGGCCAGCTTGGCCACGAGAACATTACGACCAAGATCCACCAGCCCAAGCTTA
TCGAAAGCATCCGCGACAAGAAGATCGTGTTTGCCGCCGTGAGCTACCACCACAGCGCCATTGTGACGGACAAGGGCGACCTGTACACGTTTGGCATGAA
TGACTGTGGCCAGCTGGGCCAAGACACGACCACACACGTGTCCGAGCCCCAGCACGTCAAAGCGCTCGAAGGGTATATTGTATCGATGGTCAGCTGCGGC
TTGTACCACACTGTCGCATGCACGTCCACGGGCGAGCTGTTTACGTTTGGCAAGAACGACTACGGTCAGTTGGGGGTAGGCCACAACCGCCAGAGCAAGA
CCCCGTGCTTGGTGGCGACCCCGAACGACCATATTTGCTTTGTCACGTGCGGGTACTACCACTCGGTGGCGGTGGCGACCAACGGGCGGTCGTTTTCGTT
TGGGCGTAATGACTACGGCCAGCTAGGCATCGGCACCAAGGTGCATCAGAGCGTGCCGCACCTGATCACGGTCGGGCCTCGCATCACGCGCGCCGCGTGC
GGCTGCTACCACACCGTTCTCTTGTCCGAGCAAGGGCTCGTGTACACGTTTGGAAGGAACAACAAGGGCCAGCTGGGCAACCGCGGCAACACGGACTCGC
TCTTGCCCGTGCCTCTGCATGTCCGCCCCGAAAAGAGCGCGCGGCGGGTTCTGGACATCGCGGCGGGATTTTACACCACGTCGTTGATTGTCGAGCGCAA
GAAGGATGGTGACGTGGCGACGGCCGACCAGAGCTTGGTGCTGCCTCTCTGCGGCCGCGTGGACATTGACCGGAGCGGCGAGATTGAAGGCTTGAGTAAC
TTTGGGAGCATCAGCGCCGTGGGCGTGAGCTTGTATCGCGGCAAGTGGTTCTACGAAGTCGAGGTCGTCACGTCCGGGCTGATTCAAATCGGATGGATCG
ACGGGTACTTTCAAGGGTCATCCGACCAGGGTGAAGGCGTAGGCGACCACGCGCACTCGTGGTCCTACGATGGCAACCGGCAGAGACGGTGGAACTCGGG
ATCGTCAGCGTACGGCGACAAGTGGAAAGCCGGCGACGTCATCGGGTGTCTGCTCAACCTGGACGACCTCGAAATGCGCTTCTTCCGTAACGGCGTAGAC
CTTGGCATCGCGTATGCGGACCTGGCGCTGAACGCATCGGACGCTCGCGCCGGACTCATGCCTGGAATCAGCCTCGAGCGAGGCGAAATCATCCGCCTCA
ACCTCGGCCACCGCCCGTTTGCGTTTCCCGTCAACGGCATCGACGGCATCGCGCGAGCCATCGTGTCGCCCTCGTCGCAAGTGGTGCTGCAGACCGTGGC
AATCGCGACGACGGCCACCGCCCCCGAGGCCCTAGAAGGATCGGCGCGGATTCTCATGGGGGATAAGCTGTTTGTGATCGGCGGAATGCTCTCAGGCCCT
ACAGGAAGCACTGGCGTGTCCACCAACAAGGTGTGGGTGTACTCTCAGTCGGATAAGGCATGGGGCCGGTGGAGCGACCTCCCCATCGGGCTTCGGTACC
ACCAAGTGGTAGCCATCGACGACCACACGCTGCTCGTGATTGGCGGTGAGCACGACGGCCCCGTATCTCGCCACCTCGACCTCTACCGCGTCTCGACGAT
CGCCAACGCCGATGGGTCCTTCCCGCCCTGGGAACTCGTCCAAGGCAACGCGGCGACGTCGGCTCTGCCACTTCCCCGCGCCCACCACGCGGCCGCCGCC
ATTCGCATTCGTCTGGAAACTCTCGTGCTCCTCTACGGTGGCAAATCCAACGACGATGCATTACTAGGCGACACGTGGTTCCTCTCTCTGGAAGACTACT
CGTGGGCCAAGCTGCCGTCATCGGTGGCGCTGGATCCAGGCCCGCGCTTTGGGTGCTCGTTATGCGTGGTAGGGGAAAGCGTCTACATCTTTGGGGGATT
GGACAAGGAAGACCGGTACCGTGCCGACCTATGGCGGTACAACACGTTTGATCGTGTGTGGCATTTGTGTCACGACGATTACATTCACACTCCACGGCCA
TCGTCAACCGACAAGGAATTCAATCCGCCAATGCCGCCCCCCCGGACCTACTACAGCATGGCGTCGGACCTCGGGCATGTATGGATCTACGGGGGTGAGA
ACCGTAAAGGCGATGTGCTCGGAGACCTCTGGGGATTTTCCCTGACAAAGACCACATGGACGCAAGTGGAAGTCACGACCGACGACGGCGTCAGTGGCGT
GGGTCGTGCCGCGCTGTTCATCGAAGCTGGCAGCGTGTGTGCGTTCGACCCGCTGCAGCCGTCGACGTGCTTGTTGTACGGAGGCCGGGCGAGTCGCATT
GCTGCTGGAGGAGCGACGACGATGACGAAATGGGAAACCACGATCCGATACCTGTCTCCCACGTCGAGTTCGAAGCTGCCGTCCTCGGGCATGACCTCCT
TGACAGCGTCGTCGTCAACGGCGTCGCTGGGCAAAGCGTCGACGGTGTTGGCGCACTTACGGTCCAAGCGCGCGCCGCTGCTGTGTCCGCCCACCGCAGG
CGACACGGCGATCTGTTTGTTGTCACATTTGGACCGGTTGATTGGCGGCGACGTCGCGCTCGTTGAGGCGGACTCGATCCAGCCGTCTCGGTGCAGCTAT
CGGTCGCTGTGCATCGATGCAAAGGAGTCGTCGTTTGCTGTGCTGCTGCAGCTTCTGTCGCGGCTGTCGACGTCGGTTTTGGCCCCCAACGTTGACTCGA
CCACGGACTTGTACCCGCTCGTGGTGGTGTTGCGGCTGGTGAAATTCAACTTTTTTGAGGTAGGCGATAGCCAGCAAACCAGTGGTTTAGCGTGATATGT
GTGTTGTAGCTGTCGACTTCGTGCATGGACGTGGACGACATGGGGTTTGCCGCGTCGTCGACGGAACGTGGCGGGACACTGTTCCAACTGCGCGAGCTGC
TATTTCAGCTCGCCGACGTGCCGTGGACGCCGACAGCGTCCGCCGAGGTCGACTGGTTTGGCCACGTCATCCAGCGCGAGACGGTGGCGACAATCAACGC
GGGGTTCTCGGTCATGTTTCCGTCGCTACTCGACCGCCTCGCGGTCCTCACAAGACTCCTGCACGACGACAAGAAGGTCTCCAACCTCCTCGTGCCGATG
CTCGTGCCGAACTTTGCCTCGGCCAAAGCACTTTTCGCACTAATGTCTGAAGAATCCACGCTCGTGGCCGAAGGCGACCGGTGTCACAACGTTGTGACGA
TGTTCGCCGACAAGTTGCTGCAATCTCTGTGGCTTAAGTCGACGTCGTTAGGGATGCTCTCAGCCAATGTGGACACGACCATGGAGTTTCAGTGTTTGAA
CGTCCTCCTTCGAGCGACGGTATTCTGGTCGTCCATGAACCAAGGATGGACCATCGCCAAGCACATCTGCATCCGACTGGTGCACTATATGCAGCTTCTC
CTGGACACCGCCGCCGCCGCGCCCTTGTCCCCCGTCGCTGTGGCGGCGTTGCTGTCGACCAGTTTCCCAGGCAAACTTCTGCCGTTCCTCCTCCTCAACA
TGACCAGTTTACCGTCCATTCAGCAGAACTTTTCGTCGGCGATGGCGGACCTGTGGCCAAACTTGGAGATGCTGCTGCATAACATCCACATGTTCATGGC
AACAAGCGACGGATCGGCCAAGTCGTTTGAAGGAAGCTCGTCGGGGTTGCCTGGTGGCACGACTGTGTCGACTCCTCTGCTATCGTTGGACAACGACACG
TTGTTGCAGCATCCTGTAGTGCTCAGTGCTCGGATGCAGGGCCTCTTGCAGATTCCACCCACGACTGCACCCCGTGCGTCCATGCCGGGTGCCGAGTTTG
CTACCCGATTCTGGGAAGTCATCCGCACCACGAGCTCCGCATTTCACCGGATCAACGTCATATCAAGGGATTACGACTTGTACCGAGTGGTGTTGGCTCC
GTCTGCTGCCGCCGTGTTGCAGCAGCGGTCGCTCGTGGTGGGGTTCCGAGGGGGTACGGACGACCATCTGGCCAAGACGCCGTACGACAGCGCCAAAGTC
AGTTTGACCTTTTCATGGGATGTATTGACCACGCACATTCAAGCAGGCGCTTTGAGTTCCAAGTCCCCCTTCTCCACGATGGCATCGTCGTCGCCGACGA
CGTCCGCGCCTGCGACACTGGGTGGAGATGGCGATGGGGCGTGTATCGAATGGCTGCACGATTTCCAGAACCTGCTGTCGTACCTGGGCAGTCATTACGC
GTCGTCGCTGATTCTTGCGACAGAGTCGACAGCTGTACCGTCGGCCGGATTGGAGCGATGGCTGCAGTCGCCCTTGTTCCGAGGCGGGTTGGAGGAGGAG
CAGCCATCGTCCCCTACAACAGACAGCGACGACCACCCTAAAGCAACCCGCAACGCACACATTTTACAGCAAATACTGGACAACGAAGGGGCCGGGGCGA
AACTCGTGGAGAAGGTCAAGACGGCGCTCGATCCGGACGCGGCCTCGGCGCACGCGAACCCCAAGCTCCGTGCAGCATCAACTCGCATGAAACGCATCGA
TAGTGTCGAGCGGACGCTGGAGAAGAGCGGGGGCTTCGAAGCGGTGGACCGAGCGGTGCGCTCGACGTTTGCCGTTCTCCTCAAGCACACACATGTAGCG
TACACGAGTAACCCTGTGACACGGGATGGCATGCCCGGGGAGGCCCTTCTCGACGCCTGGAGAGCCGCGCTGCAGCTTCGACGATGGTACGTAGCTAACT
ATACACTATGCAATGTCAAGGCACTGATGACGTGGCAGGATTGTACGAGAGCAACAAAAGCTGGCCGTGAGTTCGAGGTACGAAATGTAGATTGAAAACT
CCATTTTATAACGTCTTGATGGGTTTTGAACGTCTGTTTCTAGCGACGGCAAAGTGAACGACGACGAAGACAACGAGTTGGCCAAGGAGCGTCAACAGTC
GCTATACAAGCAAGTGTGCGACCCAATCGTTGCGCGCGCTCGGCTTTTGCTGCAGCTCGCGGCGGTGCCAGTGCTGACGACCCAGGAAGATGCTAGCCAT
TCCCCGTTCAAGATCCTCCCTGGCATCTCCAACACCCCGTTTGGTATGGCAGATTGTTAACGTTATAACATTCTGCTCATGCATGGTGTAGATTTTGCCA
AGTTGTCGTCGTCGACGGTGGCGCGCGTGGCGCCGGAAGATGGAGCCGGCCACCAAGGATGGCTGCAACAACTCAATCGGCTCATGGAAACAAAGTCCAT
GGACACGATCGAAGAAGAAGATGAAAGGATTCAGACGGATATCTTTGCCTTTATTCAGCAAACGTCCGACTCAAGTGTTGAAACGCCCATGAAAGCCCTC
CTCGAGGACCACCAACGTCGCGCGGGTCGACGACTGCAAGGCCTCGAGATTTTCTTCACGTTGCTCAGCAGCACGGCGTCCATCCCGGCCGCCCGATTCC
ACATTCTGCCCGTCCTCGCAAAGTCGTTTCGCGCCTCCCGCGGTGTGGCCGGCAGCGACAAAGTGCACTACTCGCACCAGTTGGAGTTGGCTGGCCGTTC
GAAGATCCAAGCGATTGGTCGGCAGTTCTTTGCTCTCGTGTCGCACCTGCTGGATCATTCGTCGTCGCATCTGTTATCCCTGAAACAAAAGTACTGCAGC
GGCAGCACGGACAAGTCCAACAAGCCCAGTGTCCAGACCATGCACCAACACGTCCACGCCATGCTGTTGGCGCTGGACGTGTGCAGCATTCCGTACACCG
CCGACGACTGGGTCCACTTGTCGGCCACGAGGCTGCCTTCGTTCTTGACCGAAACGACGAGTTGGGCGAGCTGGAAGCAAGTGTTTGCCATCGAAGACGT
TGACGAGGCCACGACCATCAGCGAATCCGCATCCCACCAGAAGCCGCCGATTCTGCCGGCGGGGGTCGGCTGGAGCGGACTGACCTTTTTGCACGGACAG
TCGCTGGTCGTCGAGCCTGAAACGCACATTGTCACCAGTGTCGCAAGACCTGTTCAAGCGGGAGACTCCGCCGTGGATCCCATCGTTGCCGACGACGCTG
CCGGTGGGTTGGTGGTCGCGGCTCGACCGTTGGCCAAAGGTCGCTGGTACTGGGAAATCGTGTGGCGGCACCAAGGCACGTTTCCCATCTTTGTTGGCGT
CTCAAACGGGTGTGCCAATGTAAACCACGCGTTTGGCAGTACTCCCAGCGATGACAGCAATGGCACGGTGGGGGTGCTTCTATGTAAGGACAAGCTGACG
TATCCTTCGTACCCGACGTTGTCGTCGTACCACGTATGGGCGAGACTGCAGCCTATCGGAGTGTTGTTGGACTGTGACGCCAAGACGCTCGACATCTTCT
GTGGGGTGAAACGGGTCCAGTCGTTGAATTTGGCCCATGTGACCACTGCCGCCTACTTTCCTGCCGTTGGCGTCGTGGACGGTGAAATCCAATGGGACAT
GTACGCCCCTGTCCCCGCCCGCATCTGGGCGACGCCCCCCAAGTTCACGTTTGTGTCTGGGGGGCTTGTGGCAGACTCGTTTGGCGGCAACGCGTTGAGT
TGGAGCGGTCGTGTGAAAGGCCCAAATGTCCATCTCGCTGCGGATTGTTCGACCCTCGTAGCCGGGGACTGTCTGCTCGCGACCCCCCAAATAGAGACGG
TTGTGACCAACAAGTCGTTTTTGGATGGGCAATTGTACGTGGAATTGAGTGTGCTAGCGTCCCGCCATTGTGCCCACTTTGTGCTGGGGGTGGTGGACTC
GACGTTCGTCGCTGCAGACCAAACGATCGATGGATTACACCTTGAGTATGACGACATTGAACAAGACCACGACGGACTCCTCGGAGTTCTCTTTGACTTT
AGCGAAGGCAAACTCACCGTGTACCAGAAACGCAAAGAAGCCATCGTGCACTCGGTCGACTTGTCGGGACTGACGCCGCCGTACGTGCCCGCCCTATCGG
TGTTGTGCAACGGAGCGATTCTCTTTACCAACTTTCATCCGCACGCGCGACCGCAGCTCCCCCCGTCGTCCATTTACCCCCTCGCCAAGAGCTCCGTGGC
ATCGTCGTCCGCGACGGAAAAACAAGTGGGCAAAGTGCTCGAGTTCCAAGTCCTCACGTGCGACGGCGGCGAATTCAGCGCGTCGCACGCCGTGACCAAC
CTCCTCGTGGACGACTCCACCGTGTACAGCTCGGCCGGGTCGCAGAACATTTCCCTGGTACTCAAGCACACGTCGGACACGCCGTTCTGCATCACGTACG
CCATGGTCCGCGGTCCCGGAGCTGGCTACACGGCGCCGCTGCAGCACGCGGTGGTGTTCGTCATGAGTGCGCCTCCGGAATTGGACGAGTTGGAGCAGTA
CAACGGTCTGACGCCGGAAGAATTTGCGGGACTGCCGACCGCCCCAACGGATGCCCACGTTAAGCGCGACGAAAGCATCCCCGTGTTGTACTTTGTTCTG
GACGGCAATTGCTCTTCCGTTTCGAAACGACTCACGAGTCCGGTCGCAGGACGTTATGTCGTGGTGAAGCTGCTGCGCCCGACCAGCGGCGGCAACATCG
ACGTGGGGTACCTTGGCTTCTGCGGTGCGTTCGACAAGGAAAATGGACCTGCGTACAGCGACTTGTACTGGGACGACTACTTGTGCACGGAATGCCACTT
GTGTCCGATTCCAGGCATCTGCTACGTCAGCGACGAAGACGATCAAGTCAAGATGTGCTCGAGTTGTTACGATGACCAGCGCGGCAGCTTGACTACATCG
TTTTACGCGTGCGTGCCGTCTGACGGCGAAGATCGAGGCGACGCGTCCACGTCTGTACTTTGCGCACCACGGAAAGCATGGATCGAGTATGTGCAGGCTT
TGTACGAATCGACGAAACCTTCGACTTCCAGCTTGGGCGATCGCGGCGGTTCCGCCAGTCCCGCCAAAGCCTCGATGCCAGACGACCTGTTTGACGACGT
CGAGTTGTTTGCGTGCGGTCAAAACAACTATGGCGAGCTGTGTCTTGGCCACTGCAATTCCACAAGCAAATTGGAGCACGTGCCGCTGTTCACGGCGAAA
AGCGTCAAGCAAATGACGGGCGGCAACGAAGTGCTTGCCGTGGTCATGCGAGACGGCGGCGTGTACACGTGCGGACTTAACAAGAGTGGGCAGTGTGGTA
ACGGCACATTTGAGGAGCGCGTGGTGCTGGCGACCCCCGTGCGTGCGCTCTCTGGCGTCCCCATCGTCATGGTGGCGGCCGCCAACGGGTGCGAGCACAT
GATCGCGGTGGCGCAGGATGGGTCGGCGTACTCGTGGGGGTACAACGACCGAGGCCAGCTCGGCCTGGGCTCGACCATCTCCAAGAGTCACACGCCCAAG
CTGATCGAGTCGCTCCATGAAAAGTACGTGGTGGTGTCGGCGGGTGTGAGCTACCACCACAGCGCCGTCGTCACAAGCAACGGCGAGCTGTTGACGTTTG
GGATGAACGACTGTGGCCAGCTGGGTCTCGACCACACGCAGCACCAGCACACCCCTCAGATTGTAGACGCCTTGGCGAGCCAAGTGGTCACCAACGTGTC
GTGCGGTCTGTACCATACGGCTGTCGTCACTGCCGGCGGAGACGTGTACACGTGTGGAAAGAACGACTATGGCCAGCTTGGACTGGGCCATTCTCGAAGC
GTCAAAGTGCCGACGCACATGAAATTGACCGACGCGGACGACAAAGCTATCATGGGATGGAGTGGGTACTACCATACCGCTGTGGTCACGGACAAAGGCA
AGTTGATCACGTTTGGGCGCAACGACTATGGCCAGCTTGGAATTGGCAGCAAAGAGCACCGAAACACACCGCAGACGGTGCCGCTGCCGGCCGGGTCCAA
GGTCATGTCGGCCGCGTGTGGCTGCTACCACTCGCTCATTCTTCTCGCGAACGGACGGGTCATGGTGTTTGGTCGCAACAACAAGGGCCAACTGGGCGCC
GGGGCTCGGACGTTGCCGTCCGCCGACCTCCCGCTGCCGATTCCGTCGGGCACTCTCGCAAACGACGACGTGGTCGCGATCGCCGCGGGGTTCTACAGCT
CGTACATTCTCACGGGCCGCAAGTCTGACAGCACCAGCAAGAAGACGGGAACGTCCGCACGAGATGAACTCAAGGACATCCATGCCCCCGACCACCAAAG
TGTGAGTTCTGACGCGCTCTTTGAATCGCTCATGCGCGAGATGGACCGAAATGCACTGAGCGACACCCTCAACGATACGTCGCCGCTGTCTCTCAAGCGA
AGCAACACGTCCAAGAAGCTGCCGCTGCTAAAACTGCTGTCGGGAACGTGGGCCGTGGCCCGCACGCTCATGTACCAGTCCCTTCAGTCCAAGAAACCCA
CGGAACTCCTCAAATCGTTCATCTTGTCCATGTTGGACAACCTTGCCGAGTCGTCGAAACATGTCGACGCCACATCGCATGACCTGCCAACCGGCGACGA
CGAGTTTTTCAACCTCTCGGACGCGTGTGTGGGCCTGATCAAGTACTGCGCCTCGGGCAAATCCAAGGCGGACGGCCTGAGTGTGTTATCGCAGTTGTTT
GGTAACCAAGTGTTGTGGGTACTCCTAGCGTGCGGGTCCGTCCATGCCGACGTGTGCTCGGTGATTGCGTCGTCGCCCGTCGTGCTCCACCAACTCATCC
GGGGCATGTTGTCGTCGACGCTGTCCTCGTCTATCATTTGCATGCGGCTCGGCATGCTCATCTTCCCCCTGCAGTCCGTCTCGGCCGTGAACAAGGTGTA
CAAATCCATTGCCACGCATCCATCTGACATTATGACGTTTTTGTTCCTTGTTGTGGGGTACCCGCTGATGTTGCGGCCGCCGCTCTGCAAGCACGAGCTT
GGCATCGAGTGTGCCACGACGTCGTTGTGCAAGTACTTCAACTGCACCAAGGGTGTGGCGGTCGACGCCCCCATCTCCGCTGCGCTGTCGGCGATGGTCG
ACAAGCATCACATCCGTCACGCGAAGTCGTGCGAGGCCGTGTCGCTTGTCCGGTACCTGACGCTGTTTCCAACGTGGAACAAGGCGGCCGGGGCCACGAT
CACCCGTGCGCTGGAAAAGACAGACGTCGTGGACGATCTCTTGGCCACGATCTGCAAGTTCTACGAACATTTTAGCACTGGCGACAGTTTGCCAGGAGAT
GACTTTGTGCATGACGACGACGTAGTGGTGCGGCAGCCAGAAAACACGTCGCCCGAGCTGGATGACCCGTCGTCGCCGTCGGCGGCGGCGCTCGACGGTT
CTACCGACAAGGAAAAGAACATTGACGTGATTTCCGAGTCGCTTTCGTTCGACAAGAAGGCGGCGGCGCTTCGGAAAAAGGCCAAGGACGCATTGGATCA
TGCGACGCTCCTGTTGGCGTCCATTGGTATTTTGGGCGGCCACACGGAACTGCTTCGAGAAGGCGGACACGTTCTGTTTGAAGACTTTGAAATGTGCGGG
CGGTTCAAAGGCGGGGTGCTCGTCGGCCTCAAGCGCAATGCGCGGGGCGGCATCGACGGTCACATTTCCGTGGCGGACGTCGCTGCACCGTGTACGTCCA
CGACAAGCAAAGCCGACCACGTCGACACGTTGGTGGTGCCGCTCAAGAATTTGCATGCCGTCGAGCGCATCCCTGCGATTCCTCAGATGTTTGACGACAA
CCTGAGCGACGCCCTCCAAGCGCTGTCCAAGCTCATCGTGCCCGCTTCGTCGTTTGCGTCCAAGCCTCAGTCGTTCCACCCGGTCGTGCACTCGATAGTT
GGTGTGGTGCTAAAGTCGTTCAAAAACCAGATTCGGTGGCGGTCCACCAAGGCACTGGCGTCGGTGCTCAAGCAACTGCCGTCCCTGGACACGTCCACGA
GCAACAACTTGGACGTGTCGATCGTGTCCAACATTGCGTCGCTCTTGGCGTCGGAAAGCAACAGTAGTACCACCCCCCGACAACAAACGTGTACTGACGA
CGACAAGTTGCCGTTTCTGCACGCCAAGTGGTGCGCCCTCAAGGAACATCAAGCGTATTTGGCCGCGGAAAATGTGATCGACTCGGCGTTGGACGCGAGC
GAAAGCCATGTCCGCGACGAAGTCGTGCAGCGTCTCGGGAACGAGAACGCGCTCTCTTGGGGCATCGATGCGATTCAAAGCCCCAAGAAACGTCAGTCTA
GTGTCGTGGCCAAGGCCAACGTCAAGCAGCACCAGCCGTCATCGCTAGAGTACTCGGCGTCGGCGGTCCCGACGGGAGTGTGGGGGATGTTGTGCCCCGT
CCAAGTGGCCGACACGGAGCGAGACCATTCGTTCAACTCGAACTTTCACCTGCGCTCGCCTGTCGTCCGCGTCGGTCGCGCCACCGACTCGTGCGACATT
GTTATCAATGACCGCAGTGTCTCGGGGCGCCATTTCCACCTCCGGCGGGTACGGCAGGACACGGTCGGCACGGACGAGTACTTTGAGCTGCAAGACTTTT
CAAAGAACGGCACCATCGTCAACGGTGTACGCGTTCACGGAGCTAGTATCCGCGTGGCCCATAGCGCACGCATCTCACTCATCCTGTCTCGAGGAGGTAT
GATCACGTACGAGTTTCACGTGATTCCGCAGCACCCGTCGACGTCGCTCCTGGCCTCGGAGCCTCTGTCACTGCTGCCCAGTGCCGCAGCAATGTCGGCT
GGAAACGAACCGCAGCAGCAAACCCAGCAGTCCGAGCTGCACGAGCCTCGAAGTCCCGCCGAAGTGCAAAATCGAGCCTTGTCATCAGTCGCCTCGAGCA
GCTTGATGATGGGCAACATTCGTGCACGCTTGGGACCTCAAGGCCTACGGTTGATCACCACGATCGGGGAAGGCGACGTACCCCGCGCCCTCATTTCGCC
GAATCCGGCCGTAGACTCGCCCCGCGTCGGGGGGAATCATCCGACGAACCCGCCCCCCATCGCCATATCCATCCACTCCCCCCGTACGCCAGCGGTCGGG
TCGCCCCTGGCGTATCCGTCGTCCGGCGTGTTGTCCCCCGCGTCGTTTCAACAACGGGAAAGCCACGCTCCGTTGGCACCCTCATCTCTTGCTCCAAATG
CGATGCCGCATGGGGAAATGGCCGTGTCGGAGGCCCTTCGCATCGCCCTCGGCCGAGAGAGTTTGAACCGAGACCGGCTCGATCCGGACCTACTGACTCG
AACTCGCGTCATGTCCGGGACAGGGGAAGTCTCGTTCGCCAAGAAAGCGCCATCGACGACGTCCTCCTCCGTACGACTTCGTTTCTCCATCTGTCCGCCA
TGTAATTCGTTCGTTTTCGTCGTAGAAACCCGACGACAAAGGCGGTTCGCCGTTCAGCGATCTGGCCAAGGACTTGTGTACCCGCGTGCGTGACTTGGGG
GGGCATGGGGTCGAGGTCGAAATGTGCGAAAAGGCTCTCCAGCTGCACCAAGGCGACGTCGTGCGGGCTCTCAAGTACGTGCAGGAAACCATCGGGAAGG
CCCAGGTACGCCTACCGATGCTTGAACAAGTTCATTCTAAACAGAGACGGGCAGAGCATGGGGTTGAGTCCTCAGCACCATTTGGCGGCGAGAAGCTTGT
CGCACATCCTAGGCCGCAGCGTGTCGGTATGTTCGCACGCGTTGAAGCAGTCGCGGGACAACATTGGTGTCGCCCTACGCGCGCTCTTGTTCTCGCCATC
AACCCCCTCGTCGTTGTCGGACGTTGTTGGAACCACCCGCGGCGACGACGACGACGACCAAGACCACCGGGACGACCTGGTATCGCAACAATTTGACAAG
TTTGTGTCCCAGGCAGTGGACCAGCTCAGTACGTCGGCCGACATGAACGACGCGGAAAACCCAAGTTATTCGCTGCTGGACACGTCAGTGTCTGCGTCCC
CTCGCCGAGCGAGTCGACCGATTGCCAGTCCTGTGCGAAGTGCCAAAGATGGCAAGGGAAAGAAACCCGACGGCTCCGACGCCGCGGTCGTGCCGTGGAG
TGTGTGCAATGCCCACGTCGAAGACCGCATCAAGGGGCTGAATTGGCGGGATGTGGACGCCGAAGAGGACAGCGTGAGCCAGCTTTTGAGCGCCGTGCAT
GCGCGCAAACTGCTCCTACAGGTCATTCGACTTCTGCAACCGGTACGTCAGGATCCGTCCTCGAAGAAGTGTCATCGAATATATGTTCTTATAGCATCAA
AACAAGTCGGCCGAGGGCAGTCCACTGTGTAGTTTTGGCGACCGATCTACATTGCGTCAGCTGGTCTTGTTCTCCGAGCCGGTGGACGGCGACGCTGAGA
CGGTGGCCGCACCGTCGACGTCCAATGGCCGCATCCAGCAGATTCTGGCGCGGATTTCGCAGGACGTGCTGAGTGCGTCGGCATCGCGAACGCTGGAGCA
CAACATGCGCACGTTCCAGAACATCTCGACGCTGGTGAGCAGCATTGACGAGAACGACGGCCGTCCTCCGCAGTCGTCGAGCGATGCCCAGCACAACACG
GCGCAGGCGGTGGTGCGGGCGCTCTTAAGCTCCACCGACGACAACGACCACGAGTTCAAGACGGCGATTTGTGAGGACTTGGTCATGGACACGATGATGC
ACGTGATTTCCAAGACGTTTTCATCCAAGGGGATGCTAGACTTTGACGCCAAGAAGGAGTCCGAGTACCCCAAGGGGCCGTTCCTGCTCTCCAGCGGCCT
CGAAGTCGCCGTCGTCGCAACGTTCGAGAGGGTGTGGGGCGTGCCGTACCCCGATCCGCTGCTCAACTACCGCCACAAGTGGCGCAAGAAAACCAGTACC
GGCCTCGACGGTGGTCCATCTGCGTCCACTGCGCGCGCGACATACGACTGCAGCGTCACGCTGTGGAAACCCGTGCTGCCTTCGTCATTCCAAACGACTT
TGGTCGCCCCCGACAAGTGGTTTGCGCTCAGCGTCGTGGCCAAGACCGGCAACGACACCCCCACGTCCCCGCTGGTGCTGGTGCGAGACAACCAAGACGG
GTGTCTAGCACGACCCCTGCGTTTTGACTGCGTCGACGTGAGCGGCAAAGGACTGCCCAAGAACTCAGACCTGGACTTGGAGTTTGAACGCAAGCAGTTG
CGGACCGTGTGGTGGCCTGTGGCCCCGCCGGGGTACGTCGCGTTGGGGTGTGTCGCCGGCACCAAGGACGCGCCGTTCGATGCCCCAAGCGTCGACAGCT
ACCGGTGTGTCCGTGCGGATTTGGTGCAGGCGTTGGACGGCCCCGCGAGCTGCATTTGGCAGGCGCCGACAGTGTCTTTGTGGACGGCAGCATCCGACTA
CTCGCAGCATTTGATCCCCACGACGGGCGCCAGTACGGACGAGACTGTCGTGCACGTGCTTCAAATGTCCGAAGACGACCGGGTCCTATGCGCGCCAATC
ACGATTGCGGTCGTGCTGCGGTTTGTGAAAGTGCTTTTGCACGTTCAAACGTACATGGGGAAGCAGATTCTGGCGCCAGAACTCACGTCGGCCCTGTTTG
TGCTCGTCAAGCAGGCGCTCGGGGACAAGCGGAGTCACCCTGTGAGTGTGGAGCTCGTGCGTGCACTCACGACGGTCATTCGGGCGGGGTGCCCGTGGAA
GGACAAGGAAGGGGTGCTGTACTGCCGGTCCAAAATCATGTTTTTGTACCAAGATCAAGAAGGCAGCCTCATGTTGAGCTCGCTCTTGCAGGCCCTCGTG
GAGCTGTTGCTCGTGGTGGACAGCCACCACCGCGACCACACGTTGGCGACGTTTGCGACCCTTCCAGCGTACGACGTGTCGTCGACGTTGCCCTATCGAT
TCGCAGTGCCCGAACATCCCCATGTGCATGCTGTCCACTCGTTGGCCAAGGTGGCCGTGACCAAAGCCAGTTCCGACTACAAGTTCGCGGTTGGGTTTAA
CGACAAGCCCGCATCAGTTGCCGCCGACGCTATAGGAGGGGGCACTACGGTGACCGATCCGACGTTTGCGTCCGTCCGGTTCGAAGACGTGGCCCCCGTC
CAAGTGTTTATGGAGACGCAGACAGTTGCGATGCTCGTGTACTTTGAAGTGCACGTCGACGACATCAAAGTCGGCAGCAGCGGCACCAAACCGCTCGGGT
TTTCGTTGGGGTTTTCTATCCGCGACTTCAACGTGGACGACGGCGTGTGCGTCGGTCACGCCAGCAAAACGTACTCGTTCACACCCGCGACGGGCAAAAT
TCAGTGCGGCGACCCGTTGGTGGATGTGTGGCCGTGGTCAGACTCGGCGCACGCCGTCGGTCGCGGCGATGTGTTTGGGTGTGGGCTGCGGCTCGACAGC
CACGAGATTTTCTTCACCAAGAATGGTCGGTGGCTCGGCACGGCATTCTCGTCCATCATTGGCGACATGCAGTTGCATCCGACGGTGTCAGTGGACGCCG
ACATGTCTGTGGATGTGGTGCTGAGTCACGCGACGGAGAAGCATCTGTTCCCGCTGGACACGACCGACTGGGACAGCCCCATGCACGGGTTCGAGTGGTT
TGATTACCTGCGCCAAGTGTACAGCATCATGCAGTCCCTCGTGGAGCGCAAGCCGCTGCCGGACGAGTTTCTCCTGAGTGCGGACAACTTTTTGTCGACG
ATATCCACCGACGTGTGCCAGAGCTTTGCATCGGTCCATCCGTACGAGTTGGACTTGCAAGAGGCGACGATCCACATTGCGCTGGCCACGTCCATGCGCA
TCAAACTGGATCCGCAGTGCGAAACCGCGGGGTCGCATTGCCTTCAAATCGTCCAGGGGAGCAGCAGCGACGACGCCGCCGAGTCCGAGGTCCGGACGTT
CACGGGGTCCTGCGGCGGCCAGGAGATTACCGTCGATGGCAACGAGTTCACGTGGCGCTTTCCTGTCCAATCCAACTTTCAATGCCGGATCGATCGAGTG
CGCAAAGGACCGTACATCAAGCTCGAGAACCGCGACACCCGTATGAGCCTGACCCGCGACAAGGGGTGGCAGACCGCCGTGGGCGTCGCGCGCTTCGACT
CGGGCGTGCACACGTGGGAAGTGAAGATCGCCATGGTGACCGCCAGCTCCAACGTATTTCTCGGTATTGCTCGAAAGGACGTCCGGTTCGACTCGTATCT
GGGCAAGGACAACCGCGGGTGGGGGTGGATTGGCAACCGCGCGCTGTGGCACAACGGGTCCAAGCAGCGCGGGACGTACGGCGAAAAGTTCAAGACGGGC
GACGTGATACGCATGGTGCTCGACTTGAAGCGCGGCACGCTGAGTTATGCCTTGAACGGGAAGGACTTGGGCGTGGCGTTCGGGCCTGGCGGCACTGGCC
CAAAGCTAGAAGGGTCGTTCTACCCCGGGTTTGCACTGTACAATCAGAGAGATGTGGTCGAACTTATTGGGGGGCACCGCTTAGAAGACAGCGACGCTAC
ATCCGCGGTGGCGAACGTCGGTGGACATGTAGACGACAGCGCCGTCTACGCGAGCGACGACGAAGAAGACGCGGAAATCAACGCCGAGTCCGTCCCGAGC
TATCGCGTCGAACTCGCGACGGTGTTGAGTCAGATGGGGTTTCCCATGGACTGGTGTGTGTATGCGTTGAAACATTGCGACGACGACGCTGAGCAGGCCG
CGGACTTTATCTTGGGCAACATGCACGCCATGGAAGCGCTGGTTCGCGAAGAGGCCGAGGCGTACAGCCGATCGCACGTGGCTCGCGAAGACTGCCCAGC
CCCCTTGTCGTCGGACGATAGTCTCGACGTGGGGTCGGCATCTGTTGTGCTTAGTTCGGACGAAATGATGTCGACGTCAGAGGCAGACACCGCGGTGGGG
CTGTCGATGGCGGCAGGGGATGCCACGACGGCGACGACGAATGAAAAGTGGGGTGTGGCGTTCACAGTCGTGCCAGAGTTTTCTGTGGCGGGGCGCCAAC
TCCTCGCCCTTCGGTATGCCCCCGCGCTGAAAGAGCTGCATGCGACGCTCGCCGTGTTTGAATTGGAGCACGACGAAGCCATTGTGACGCTGGTCAATGC
GTACTGCGAAGCCAAGGCGGAGGCGAGCGTTCCATGCGACCCCCTCCGACTCCGTCCGGACGAGTTCCACCCGACGGACGACGACTTGACCGTCCACACG
TGCTTGGGGGGCATCCCCCTGCCGACCCTCCAGGCGCGGTTTCTCATCTTGCGCAACTTCAACGCCCGACTGCAGCACGTGCTGTCGCTCATCGACTATT
CTGCGACAGAGTCGGCGCTGACACGATGCATCCGCGCGCTACGGGGATGCGTGTTCCAGACGGTGAAACTGAACTGGTGGTTTAGTATCCTCAAGGAACA
GCAGACCCCCGCGGCGGCGCGGCCAGAGATCGAAGTGGACCGGCTCAAGGCGGCCGAGTCGACCAACGGCGTCCTCCACTCAGTGTATGCGCAGTCGTTT
GCCCAGCTGCATCCGCTGCAAGGGTCGCTTCTGCGGGGCCACGACCGCGCGTTCAAGTGTCAGTTTGTCGGCGAGTTTGGCGACGACTTTGGAGGTCTGT
ACCGTGAGATTCTGGCGCAAATGAGTACCGAGCTGCAGACGCCCAAGGTGCTGCCGCTGCTCGTGCCATGCCCGAACGAAATCAACAAAGTCGGCGAGAA
CCGAGAGCTGTTTGTGCCCAACATCCACCTCCGCAACGACCCCAAGCTCGTGCACATGGCCGAGTTTCTCGGCAAGTTGATGGGCATAGCCATACGAAGC
AAGACGCCGCTCGACTTGAACTTGCCCCCCGTCGTGTGGAAGTACCTGGTTGACCAACCCGTCGTCCGGAGCGATATTGAGTCGATTCACCAAGGCTGCT
TTCAGGTAAAACATTGCATCTTTCTCGTCCAAATTGAACGGATTCTAAGGTGTTCACCATGTGTACGAAAATATGATGTAGGTGGTGGACACGATCAACA
ACATCACCAAGCACGGCATCACGCCCAACATGTTTGACGATCTCATTGACGCGTCGTTCACGGTGCTGTCCAGCGACAAGCAAGAAGTCGAGCTGGTTCC
TGGCGGCAAGCAAGTGCGCGTGACCTGGGACGACAAGGTACCCCCCCACCCATCGCACGTACTTTCGTGGTGTAAGGCTGACTTTTGTTTGCAGGAGGAG
TACGCCCAAGCGGCGGAAGCGTATCGACTGTCCGAGTTCAAGCCCGTGTGCCAAGACGTGGCCCGGGGCATCGCTACGATCTTGCCACTGCCGACGCTGG
GTCTGTTGACGTGGAAGGACTTGGCAACGCTCACGTGCGGCAAGTACACGGTCGACATTGACCTGCTCAAGCGACGGACAACGTACGGCGACGGATGTTC
GGGCACGGACCCGCACATTGCGTACTTCTGGGACGTACTGCGGGAGTTCACGGATGCGCAGCGGTCGTCGTTTCTTCGGTTCGTGTGGGGGCGGTCCCGC
CTCCCGACCCACGCGGCCGACTTTACGCAGGACTTCAAGATCTCCGGCATGCCCAAAGCCGTGGGCAAGGCCGACAGCTACTTGCCCCTCGCCCATACTT
GTACGATTTCTTGTCGTGATCATCCAGTTTGACGATCGAAAAGTCGACGTTAGTCATGTGTGTGTTTTATGTAGGCTTCTTCTCAATCGACATGCCGGCC
TACTCGTCCAAAGCAGTGATGCGGGACAAACTTGTGTACGCCATCACACATTGCTCATCGATTGACGCGGACAACACGACTGTGGCCCAGCGGGCTGGCC
AAGGCATCAACTGGACCCGCGCGGCCAC