Description :
From Genome Similarity Track
Location :
Scaffold_38:33574- 34841
Transcript NameFunction/comments
g10991.t1POM58817.1 Amino Acid-Polyamine-Organocation (APC) Family [Phytophthora palmivora var. palmivora

Sequence
1267 bases(100 bases per row)
GCGCACCGTCCTGAGTACGCTCGTCTTCCTCTCTTGTCGGATCTTGCAGCATGAGGTGATGTCGGGGGTCCCATGGCAGCGGCTTCAGATTGCTTGCGCG
AGCTTCCTCTAGCCGAGCGATTTCGGCCTTGCACACAATGGGCTGGCTCCAGGAACCCTTCAGCGCTTCAAACTGAGCTGCGCGATCCTCCTGGGCGCCG
GCCAAAGTAGCACGGACAAACTTAACGGGAACTCGCCGCTCGCTCTCACAATCGCCATCGAGGAAGTCCAATTGCAGCACGCGGTTCACTTGATCGATGG
CGGCGATGCGGCAACGATGCCAGCGAGGTGGTGAACCATTGGCGCGACGACGCCTACAGCTTTCTACCAGCTGACCGACTTTAAGGTTGGAGAGGCTTTG
AATAGAAGATGTCAACACCGGCAGTGACGTTGAGAACACCTTGGCGAGCTCGTTACCTAGCTCGGCGACAAATAGCTGCTGGATCGGCATCGGCAGTCTT
CGGGCATGAACCCGACTGAGCTTGCCAATTCGAACCTCTTCCTCTCGAGCACGGGCAATCTTCATCTCCTCGTCGAGCTCCTGCTCCCTCTTAGCTGCAG
CCTCGCGAGCTAGCTGTTCACGTATTGCACGGGCTTCATCGCTTTTGTACGGACGGATCTAAGCTCATAATGGTGGAGGTTATCACGTCAACTCAACGTA
CAGCAGATTGACGACTACGTACATGATCGAGAGCGTCAAACTGCAGAACTGTCCGCACAATGCGGAGAACATTTTCGTCGACGTGCAACATCGCCTTCTC
GTAGTATGTCTCGAGTAGCTCAAAGTACTCTGGGAACTGGCGCCAGATCGTGATGGCGATGGCAGTGGCCCACAACTTGCTGGAAATGCCCTCCATCGGA
GGTGGGGCGGTGCCGTTGATTATGAACTCAAAACTACTCGAGTACATCCAGCTTCCGTCGGGTTCCTGAGCTTCTAACAATGCTCGAATGGACCAAGGCA
GACGCCGTCGATCGGCGCTATCGAGCAATCGTCCTTTAGCGTGCTTCTTAATCTGGCCCTCCGAGTTGATCGTCGGTAGAATTGTCCTTGGACTGTCGAT
GGGCGGCTCCTTTTCACGTTGTCCGTCGGTAAAGATGGTATCGGACGCCACAGATCTGCTGAACGCATCATAGAACTCCTCGAATTTGAACGGGACCTTG
GTACTCATTTCCAAAGCTGCTGGCCGGGACAACGAACTCGGTGAACGACCAGGTTCGATCTATTTTT