Description :
From Genome Similarity Track
Location :
contig_28:335715- 337072
Transcript NameFunction/comments
g6643.t1XP_009513885.1 hypothetical protein PHYSODRAFT_248285 [Phytophthora sojae

Sequence
1357 bases(100 bases per row)
TGAGATTGAGCTGTTTGCTTTTACGGATGTCCTTGAGACCACTAGTGTCCTACCCTAAAGCCTATCCTTCTCTAATCTCAGCTGCTATCTGTTCTACCAA
TGATCTTGTCTAAAATATCCACGTAGTTGTAGTTTCATCAAAAATCCAGTTCCCATACTGGATATTATCAAATCTTGATGATTTAGACCAATCAAATTAA
TGATTATCGGACGTATCAGATTCTTGTTCTTATCCTTGAATATCTTGCGCCATTCAGATATTGGTAGACATGCATACGAAAATTTATTGTTCAACCAGAT
TGGTTGTAGTTGCGGCAATACCTGCCGCTGACGGCAACTGCGTCACAGAATGCATCTACTTGCTGTGCTTGAGGAGCGGGCTCTTTATCATTCGGGGGCT
GACGCTCCAGACCTTGAGTAGCTGTTGCACGAAATCCAGCACAACATTGGTTGTAAGTTTCAACTTTGTTGTAAAAAAGGTCTCTATTTCACATGTAAGC
CATGCGCTCGAAAGCACGCTATCTCTTGACTGGTTTCCGCGTACACTTGGCACTTACTTCTCGCGGCGCGAATCGTACTCGGCCTGGATCTCCTCGGCCG
ACTTGCCCGACGTCTCCGGCACCAGCTTCAGAGCGAACAGGTAGAAGATCGCCAGCAGCACCACGAACGGCACGTACGCGTAGTCGGTCAGAGCATCCGA
GATGTACGGGTACGACACGCCCACGATGAGGTTGCACAGCCAGTTGATACCGATGCAGAAAGACGACGCGCTGGCACGGATCGAGTCCGGGAAAATGTCG
GCCGTCATGACCCACACGAGCGGGCCAGTGTCACGCCGAACACGATCACGTACAGCGCCGTGAACACGATCGACAGCGCAGACACGTCCACGATGAAGGC
CACCGTCATGCCGATGGACATAGCCACCATGCCGGCCAGACCCCACAGGATCATGTTGCGCGCCCGAAGCGGTTGGCCAGCACGCCCGTGAAGAAGGCGG
GCCAGATATTGATGAAGTCGATGATGAGCGTGCCCACGCGCGAGTCCGAGATGCCGGCGTCCGAGAAGATGCTGCCGAGTAGTAGAAGACGGCGTTGATG
CCCGAGAGCTGCTGCGCGCAGGACAAGAGAACGCCGCCCAGCAGCTGCAGACGGTAGCGCGGGTTGAACATCGACTCCTTCGCGGGAGCAGCCAGCCCCT
CCTCGGCGTTCTCGGGCTTCTTGCTCATCTGCAGCCACGACAGCGCAGTCTGCACATGCTGTTCGCCGTACAGACGGGCGATGACCTGCTTGGCTTCGTC
CGTGCGGCCCTGGGTCAGTAGCCACGCCGGGCTCTCCACGCACATCGTTGGCGCCAG