Description :
From Genome Similarity Track
Location :
Scaffold_33:335713- 338114
Transcript NameFunction/comments
Phyci_574182hypothetical protein

Sequence
2401 bases(100 bases per row)
AACGCTAGCTTCACGCGAGGCTTTCGGAATAACTCGACTACCCTTGATATGCATTGGATTGTGCGCAATGTCATCGTATATCTCCTCAAGAAATCTCTTC
GGAAGGTCCTTGCCGTTATCGATACCTCTGTTGTTCTTCACAAATTGTTCCTTTGACATTTTGTTCTTCTTCACCTGTGGGTTATGCAAATCTGTATTCA
GCATGATAATGGAATACGCAATGATCATTGCGGTATCAGCAGAAGAAAAAGCTGATGGTGAGTCGTCCCAGTAGCACTGCGCGAAAGCCTCAACCATACG
CTCGATCTTTTGAGCTTCCCCCGGGAGACGGAACCCCCCGCTGGTTAGGAAGTGCCGCAGAGACTCTACAAGCGTCATACCCTTGAATGAAATCGCTCGT
ACATAAGTCAGCCGAATCTGAACTTTAACATCTTCATCACCCTCACCCAAGTAATCTCCAATTTCAGTCTCGTCAAAGAAATCGTGGTATATCCGGAGGA
ACGAAGTTATGCTTCGTGGCGAGTCCTTGATAAAATTCATCGCGACTAAATACTCCAATGCCTTTTTCAGGCTTTTAGACGACGATATTTCCATTGCGCG
CTTCAGAAGCTGCTGATTGTGTTTCTGGAGCTCATTTCGCATCCGAATCGAAATATTACCGCCGTACTTACGACTGGACTGGCGCTTCAACCCGGGGTGA
GTTTTCACCTCTGTTGGAGAGTTAGGTTGGCTAGCTTGATCAGAGACTACATCCCCGTTTGCTGTTGAAACCGATGCATCCTTCATGGGCGATGCTTCTT
CACCCGACTCATCTTGTTCCCAGCCGCCATTATCCATCGAAAGCATACGTGTGCGCTGGTCTCGACTGATGAGGTGGGCATGACCACTGGCGTCCATAAT
GCTGCGCGCCATGGCAAGGATTGTGCTGATTGCCAGATTTTGCAGCTCTAGGGCGGAGTCATCCCCATCGTCAGCATTGCCAATGTGTCCCCCCTGGCTG
CCCTCGCCAATCGAACCTAACGTCGAGCACAAGTGCTCAAATATTTTCCACTGCTGGATCCGATCCAAATCGAAGTTGAGGAAAATCTCCACGACGTTGT
GCGGAAGCTGTAGCCACATGGTCATTTCGTGCATAATTTCCATCTGGTGATTCTTCGCACAGGGTGCTGGGGCTTTTAGAATTCGCAGAAGGACATGCTC
AAACATAAGTGCTAGCTCCACTTTGAGATATCGTCGGTAGTGGTTCCATAGCGTTGATGCTAGCGTCAAGTTTGCTCGAAACACGTCTGGCAGCCATGTA
AGCACGGTGGAGTTAAGCGTTGACAACACAAATCTTCGAACTACCTGACCAAATACTCGCTGCTCTCGGGCTCTCGTTCCTGCTGCCAAGAGTGTCTGGT
TGAGGGCCCGAAGAGAGCTTACACTTGAGCATTGGTCGCTTTCGGCAGCCGTCTCACCAAGCCCTACAAATTTGCGGTTGACAGCTTTACTGAACGTCAC
GACTAACTGCAAAGCATTTTTCTCAGCCTGGTAGGAGGAGATACGTCAGGCGATGGCAGTTAAAGGGTAGCGCTAGATGAAGTTTACTCACCACAGAGCT
GGCATAATTAATCATCACATCAGATATGTCGTTACAAAACTTGATGGATTGAATTGACAGGTGGCTCTGCATCCACAAACAAAATCATTATCAGTATTTG
TTTCCGGTCGTCACTGCCTTCCTTGCTCAACCTTACCTTGAATACGCCCAACATGTTGTCGGTGATGGTCGCAATTTCCGCACCAGTGCTAATATCATCA
ATGAGATCCACAACCAACTCCCGAGTAAGAGCATCTGACGACTGCTCAAGTTTCAAGCCTATAGTTTCCTCAACAGTGGGTTTTGCGCTGATCAAAGTGG
CTTCGTAAGCACACATGATCTTAGAGACCAGTTCATCCTCAAAGGACTTGGCAAGGGAACTGTCGAAGTCTCCAATAAACGTGAGAGCCTTCAGAATTGC
ATGAAGTACAGGGGGGTCAAACCCTTTGGTGCACTTTCGAATGACCTTAATAGCATTGAGAAACAGGCGCAAGGTTAGATATTTTTCATACCCATTAACC
TCACTCTCGTCCATTACCTTTTGGAAGAATTGAAGTGCGGGCTCAAAACGAGACTTGATTCCTTGCTGGCATATCGAGGTGACTGCGTCGATAACCACCT
CAAGACGGCAGAGCTCTGAGCCATGACTGTCGAATACGCCCTCATCAAGACAGTGAGAGAGTCCCGCTACAGCTGCCTCAGCAGCGCTTCCCTGGCGAGT
GTAGCACGCCAACAGGATCGGATACATATAGTACTCCATTGTCTCCTTCCAGCCTATAAGTTTTGCTAAACACAAAATGAACCATTCAGACTTAAAACAA
G