Description :
From Genome Similarity Track
Location :
Scaffold_1457:3357- 7223
Transcript NameFunction/comments
Phypl_g13457hypothetical protein

Sequence
3866 bases(100 bases per row)
CATCCCGAGCCGTTGTTGAGCTCATCGGTTTACATATCACAAAGCCTGAAAACGAGTCCTGAAACAGGAGCAGAAAAGTATTTCCGCGCTCAGACTTTGG
CATATGAGTGACGAAATCCATCGACACAAGCTCAAACGGACGTCGGGGTGCAATGTTACCAAGTGACGGGCCAGGGTTCAGAGGTCGTCCCTTGGCCGAC
GCGCAATCGGAACATTCTTTGACGAACACTTCCACATCGGCGTACATACGCGGCCAGTAAAACTCTGAACGCAGCTTTTCATAGGTTCGCGTGATGCCCT
GGTGCCCACCTTGGTAATCCTCGTGAGCGTAATGCACTATGTCTGGACGCAGATCAGTCGGCACAACCAACTTCAGCTCGGACTCTTTGTCTCGCGGGCG
ATCTCGAGTGGCCACACTCAGGCGTTAGAGGACGTTCCGGAAGTCCAAGACGTACTGGTCGGCATACCtggcgatcttcttgacCTGAGCGCGGGTAAAT
TGGTCCAGCTCTCCTTTCAGATAGTACTTTATCTTCACCAAGAGTGAATCACCATCTTGGTGCGCTTTAATCCTTCGCCACCGTTCTGCCTGGTATTCCA
GCGGTCCCATCGCCTCGGCTTGCGGTAACTCCTGTTGCGACCGAGCGCGGGTTACTGCAGCCATGCCTTTAGGTATCTTGGAGACCAATTCTAAATGCAG
TCgctctccagcatctccaaccTGCCAAGATTCACCCAACGACAGGGTCTTGGACGTCAGATAATCTGCGGTTTGACATGAACCAACCGCAGACTCTTGA
ACTTGGGTTTGAGAGCTTCGACCTCAGCGAGTCTGCGTTGAAGGATCGGCTGATGGCAATTGATCAGACCCTGGGCTTGCTGAATCACAATCCTCGAGTC
ACCAACTGCAACCAAATCCTCAACTCCTCGCTCAATAGTCATAGCTAGACCTTTTAAGAGCCCATGATACTCAGCGTCATTCACAGTCACGTCATTGAGG
ATAAATCCTCGAGCATCAATCACATGCCAGCCAGGCAATTGCCACAGAACACATCCACAATTTTCTTGACGAGTCGAAATCTTGGCCGCACCATCAAAAC
TCAGCACAATACCTTTGTAACCCGATTCAAGCATCTCAATGCTGAACGCAGGTATTTGCTTGACTCGTCCCTTGGCCGGAATCAGTTCTTCAGCGACTGC
GTCCAAATGCTTGCGAGGCGTGATAGCAGCACTTAGAACTGCGGCCAAACTATCTTCGTCTCGTTGAACTCGACGAAGTTCCAGTGACCACCGGGAATGC
TCCAGACCTCATTTGAGATGTCGACCATCAACTGAATTCGACTTCAACAACCATTTCAAGACATACTATCTCGTGTAGATCATCAGTGGAAATTCCGAAC
CATAGATCAGTGGTCGAAACAGTTTCAAGACTCGCTGGATTGCCAAAACCTCCTTCTCAGCAATGTGATATCTCACCTCCGACTCGTTCAGGACACGCCC
AGTGAAACGCACCGGCTGAATGACTCCTTCGTGTACTTGTACCAACATGGCGCATGCCGCCCAAAGGTTCGCATGCGGTATAATGATAAACTGCTTCGTG
CGATCAGGGTGTCGTAGTAGCGGAGTTGAAACAATATCACGCTTCAGGATCTCAAATGCTTCCTTAGTCCAAATGAGGTCTCGCCCTGAACGCACTTGTT
CATCGTTCAGCTCGTAAAGAACTGCAGCCACCACAGGGAGATCTTCGATGAATTTGTTGTAATAGTTCAGGCTCCCAAGGAATGACTGAACTCCTTTCAG
CGTAGATAGAAACGGCAAGTCTTGAACGGACTTCGCAATCTTAGGCGTAGCTCGAATTCCTTCAGCATTAATCTCATGCGACAGGTACGGGATGATCAAC
TTGCCAAATTCACTTTTCGGGAGACTCACAGAGATATTCCAATACCGGAACCGAAACAGGAGCGCGTTCAAGTCTTCACATAGTCGATCCCAGGTAGGAG
CACCATGTGCGATATCATCAATATGCGAACTGCGTCCAAGCACGGGCCCATCTGCGGGGGAGCATGGATATTTCGCTTCAAAGCTGTCATCTGCTTCGTC
AGTATGGGAAGCTTGGTCGTCTTGTGTTCAGCACCGTGGCCGCATGTGTGTTGAAAACCCTAAACGCAGGTACGCCCAGAGTCCGGCACATCCAAGTCCA
AGAATTTCAAGACATCTTGGTCAACCTGGGCCTCCTCTTGGGGCGGCAGCCGAACGAACCCCACAGGCAGTTGTTGATCACTGCTTGGTATACGAGAGGT
GTGTTCCTGAGTCCGAACGGCATTCGGATCCACTGGAAGTGTCCAAACGGGCAAATAAATGCCGAGATCAGCTTTGCGCGCTTAGTCATGAGCACTCGCC
CAGAAGCCACTAGCCATATATAGGCTCATGAATCACATAATAGACTCGAAACCAATCAGCAAGTGATCGATCAAGGGCAGTGGATACCGAGAGAGCTTAA
TGAACTCGTTCACCACTCTGTAGTCAATACACATACGGATATCCACGCCATTCTTCTTGAGAACGATCACAATCGGCGAAGGCCACGCATATTCTGAGCG
CTCGATCAGGCCTGTTTCCAGGAGTTTCTTGATCAGCTCATATACTTTAACCAGCAAATGCAGGGGAATCTGCCTTGCGCGCTGAGCCACTGGACGCGCA
TCTCCCGCGTCCAAGCCGCAAACCAGACCACGAGCAGGGGCTGGAGCCGCGTTTCCATCGCCTAAGAGGATTCCGCGATGATACTTCAAAATCTTCCTCA
GCTTGGAGTCCATCTCTGGAGTCGCGACACCTTGAACTCCAACATCAGCCTCCTCAATTCTGTCGTCAGGACTGAGATCTTGAATTTCAGCAAGCATTGT
GAGCTGGTCGCGCAGCTGAGCCACCAACTCACTTCCTTCACGGATGTATACCGGTGGTTCTAagtccagctcttccaccgAGATCCGCATGCACCTCACG
TACCCCGCTTCCAGTTTCCGGATAGGTGTACTAGCGAACCCTTGGACAGGCAGGTTTTTCCTCGGAGTCTGCGTTCAAGGATTGACCTTGACCGCATATT
TCTGGCAGCCTGAGCTCAGAGATCACATCAACGGTAGACAGCACCGTGGCTATAGCAGCACTTGTAGCGCCTTCTGAATCTGCAGCGTCAATACTAAGAC
TTCTGGCAGCGATCTCACTCTCCTGGTCAAGATTAGTCTGTACAGCAACGTCTCTCAGCCTTGGGATGGTTCTGCTCTTCTGCTCAGGCTCCCGCTCTTC
CGCAAATATCACTCGAAGGGTCGTCGGCTTTTTGTTCACCTCAACCATCCGAACTTGCGCGGTACCGGGAGTTGATCGTAGCAAAATCTCCGACAGCCAG
GGATAACTTGGAGTTTGAACGCAGGGTGGTTCTTGATCGTACATCAACTGAGACAGCTTGTCTGCTCTCATCTGAGCTTGAGCGGACAGTGTGTTCTCAT
AGATGAGACGGTGGTTTATGTTTTGATGCTTTGGGTATCCAACATTGGCGAAGGTGTTGATGTCTTACTTGGGATGAACTTCATGTTCAGCGCTGGTGTT
CGACTTTCGATACGGGAAGGCTTGGTACAGCTCCCCGACGAGGAGACTATTATCATGTACGGAGGGCCGTCAAGAGGACATCAAGGATTGGACTTGCCGG
TGCGGCCAACAGAAACTTTGTACCTCCAGCCAGGACGGAGCGCTGTTCTGCGTATTACGTATGGTCAATCCAACCCTCAGCGAGAAGTTGTCTGGGCTGG
GCGTGGAGATCGTTGGGTAACCAAATTGTTGCCACTCCTGGTACTGCCTCCTGCCTGGACGCACAT