Description :
From Genome Similarity Track
Location :
Scaffold_65:335609- 337224
Transcript NameFunction/comments
Aphas_H257_14994Hypothetical protein

Sequence
1615 bases(100 bases per row)
CTGTTCTTTTAAGATACTGTGCTAACTATTACTTTGAAGTAATAGTTACCAGAATCAAAATTAAAGATAGAGTCAGCGGATGATATGTTGTTTACGCTGT
GGTTAGACGGACATGCTAGCCAAGTGGTCCAAACTCCAGGCAAGTCGGGGCCACGAAACCCATCCAGAGCTGGCGCATCGACGTGCGCAGCAGACGAGTC
GGCGGAGAAACGAGCGAAAGCACGCAGCCACGTCATCGTTCCCAGGATTCAACGAACTGTCCCCGCGGAGTCTGTACTTTGAAGAGTGCACGGCCGCCAA
CATCCTCCCCGAGCCGCTCCTGTCGCGCATCACGGCGGACCGGCGCCTGGAGTTGAGTCACTTTGGGCTCGGTGATACCAAAGCCATTGTACTATCCAAA
AGGTACGTACTACCCACACCTGCATACGATTGCTATGAATATATATATATATATATGGAGTTTGGGTTGTAGTGCAATAATATGACGTTTGTAGTTTGGC
CCTGATGCCCGACATTCAAGCCCTCAACCTCACCGCGAACCGACTCACCCATGCCGGCATTGCAACCGTCGTGCAACACCTCAGCGGTCGCGTGGAATTG
CATTCGCTCAACCTGAGTGAGAACGAGGTAAAGTACCTAATTGAGTCTCCTGGCCATCAAATGTACCGAATTCCGGATTCGTCAAAAAGTACCTTTTCCA
TTGATTTTAATTCCTGATTCGTACAAAAGTACCGACTACCGAATGTACCGACTACCTAATGAATATATATATATATATGTATTCCTAAGTACAGACTACC
TAATGGATACATTCCCAAGTACCAACAGGATGCAATGGTTGATAGATTGGCGAAGCCGGGTGTGCGTCGATGGCGGACTTCATATTTTCGGCACCGAACT
TGACACATTTGGACTTGTCGCAGACGAAGCTCGTCGACTCATTCGAGTCGCTGGCCAACGAAATCGCCATCCATCCGCATTTGCTGTCAGTTAACTTGAC
AAACAACGAGATTGGCGACGGCGGCGGGCAGCTGCTGGGCGCGACGCTGGCCGCCGCCACGTGTACGATCCAAGACCTGAACCTGTCGTGGAACCAAATC
TGCCACAGTGGCGCCACAGCCATCGGCCACGCGCTGCAGACGAACCGGTCGGTTCAGCACTTGAACTTGTCCATGAACCGATTCGGCGACGACGGCGGCC
ATCAGATCGCGGCGGCGCTCCTCGTCAACACGACCCTGCGCACGATGGACTTGACCCGCAACAACCTAACGGGGTCCACCGCTGTGACCTTGAGCTACGC
GATTGAGCACAACCCGAAAGCGAAGCTGTACAACATGGTTCTGGTCGACAACCCGCTCGGATGTACGGGCACGAAGGCGCTGCTGCGATCGGTGGCCAGG
GGCTGTCGCTGCAACGTCCGGCTGTCGTTTTACGACGGCGAAGACGCCAACAAAGCAGCTACGGTGCGCCGTGTGTTTGACTCGAGCTTTCCCGCCGCGC
AGTCGCCGTACGAGCTGCACCTCCACACGTCCCCGTACGACTATGTGATTGCATGCGAGGTGGTCGCGGCGGCGGTGGCGCGGCGGTGCGAGCTATTTGA
CGTGTCGTTTGAACC