Description :
From Genome Similarity Track
Location :
contig_24:335603- 337037
Transcript NameFunction/comments
g5415.t1hypothetical protein

Sequence
1434 bases(100 bases per row)
ACCCGTGCGGTCGTGAAGATGCTCGTGAAGCTGCTGGGCCCGCAAAACGCGATTTACTTGTTGAAGTTGATTTACGAGACGGTGAACAGTGAGGAAGCAC
ACGACGCTTTTTTGCTGTGTCGTGACATTCTGCACGAATCGCTGGATGGAGACAACTACCGTCATGCAGGAGCGTCGGTGGGGGATGCTACGGGCATTAC
CAGGGCGGTTCATGTTATGAAGGAGGCATACAGCGTGCTTCCCTCTTTTGACGAGCTGCTTGATGCCGCAGCACTTGTTGCTGATGTTTCGGACGAGGTG
GTTGATGGCGTTGCGCACGTTGTAACTGGGAAGAGGAATTCGAGGGTTCAAATGCGGGGCGAGTCGGATGAAGAAAAGGGGAGCGCCCCTCGCTTCGAGT
ACGTGGGTGACGAAGACGAGGAGTCTTTGGCGCATGGTCTAGTGCAGCTCACGGATGAGACGTTTGAACTCGAGGAAAGCAGTACATCTTCGGACGAGGA
CTTGAACTCCGTCCTCGAGTCGGGCATTTCACTGCTGACGCGAGTGTGCGACAGTGAAGAGGCCTCTTCGCTCTTCAACACCTTTGGTGACTTTCTGGAC
GTGCTGGTGGATTAGGCAAAAGAGGTGGCGCTCCAACTGTAAGACACAAATGCTATTTATCCAGCTGCTTGCACTGTAAGGAAACTTGAATGGGGGGCCG
CTGGGAGTATTTGTTTGCTCAGTGAATTGGACTCGTGAAGAACAGCTCCATCTCAACAGCGCGTGCGAGCCAGGGGTGCTTAATCTGTCTGCGAAAACTT
AGTGCTGTTGGCTTGGTACGCCATGTAAGAAAACCTGCTGGTAGTATTTGACTCCGTCATTGAACCATTTTGGCGGCACAACTCAACCTGAAGAGCAAAT
GAGCTGGAGCTTCGAGAGCTCACGATGCGGGGGTCAAGCGATGACCAGCATCGCCTTATTAACGCATGCGATCAAGCGTTATCCCAGTTGCCGCGGGAAT
CTCTGGCTTGTCCATCGGAAACGCTGATGGCTGGCGTTCATGCTCGGTTTGTCGGACACGAACGTGCTGATAACCACGCGATAACGTCTACAGTGGCGAG
ATTTCGCACGCTAATGAGCACGTGAAACGCTACCAGCCGCGGCGCCGTGACCAGCGACAGATTTCCCGAGCAAGTCGTAGATTTCACCTCGATGAGGAAG
CGTATCGAGCGATAGCACATTTCATTGAACAATATCCATCACGGGTCGAGCAACCTATGCGGGTGTGTCGGGACCCTTGGAGACCAGAGGAGCTGGCACG
GGTAGCCGTGCAGTGAAGATGATATTGTCTCAAGTTGCGGTGAAAACCATGAATAAACAACTATTGCGATCCGTTTAAGATTGAAGCGGGGCTACAGCTA
TTGATCCTCGTGAAGTGGAGCTCTGTTGAAGCCT