Description :
From Genome Similarity Track
Location :
contig_28:335571- 337483
Transcript NameFunction/comments
g6960.t1hypothetical protein
g6961.t1XP_009513885.1 hypothetical protein PHYSODRAFT_248285 [Phytophthora sojae

Sequence
1912 bases(100 bases per row)
CTTGAACTTGAACCGAAGCTTGAATCGAAGCTTGACACGGCAAGTGCTACTATGTAACAGTCTTGCGCCGAGGAAGGTCTTGCTTGGCGTGTCCGGCGTG
CGGTCCTTGGGTAGGCAGGTGACGAGGTTGGTGGAGGGGTTGTTGCTATTGAAAGCAAATTGAGAAGTGATTGAGATTGAGCTGTTTGCTTTTACGGATG
TCCTTGAGACCACTAGTGTCCTACCCTAAAGCCTATCCTTCTCTAATCTCAGCTGCTATCTGTTCTACCAATGATCTTGTCTAAAATATCCACGTAGTTG
TAGTTTCATCAAAAATCCAGTTCCCATACTGGATATTATCAAATCTTGATGATTTAGACCAATCAAATTAATGATTATCGGACGTATCAGATTCTTGTTC
TTATCCTTGAATATCTTGCGCCATTCAGATATTGGTAGACATGCATACGAAAATTTATTGTTCAACCAGATTGGTTGTAGTTGCGGCAATACCTGCCGCT
GACGGCAACTGCGTCACAGAATGCATCTACTTGCTGTGCTTGAGGAGCGGGCTCTTTATCATTCGGGGGCTGACGCTCCAGACCTTGAGTAGCTGTTGCA
CGAAATCCAGCACAACATTGGTTGTAAGTTTCAACTTTGTTGTAAAAAAGGTCTCTATTTCACATGTAAGCCATGCGCTCGAAAGCACGCTATCTCTTGA
CTGGTTTCCGCGTACACTTGGCACTTACTTCTCGCGGCGCGAATCGTACTCGGCCTGGATCTCCTCGGCCGACTTGCCCGACGTCTCCGGCACCAGCTTC
AGAGCGAACAGGTAGAAGATCGCCAGCAGCACCACGAACGGCACGTACGCGTAGTCGGTCAGAGCATCCGAGATGTACGGGTACGACACGCCCACGATGA
GGTTGCACAGCCAGTTGATACCGATGCAGAAAGACGACGCGCTGGCACGGATCGAGTCCGGGAAAATGTCGGCCGTCATGACCCACACGAGCGGGCCAGT
GTCACGCCGAACACGATCACGTACAGCGCCGTGAACACGATCGACAGCGCAGACACGTCCACGATGAAGGCCACCGTCATGCCGATGGACATAGCCACCA
TGCCGGCCAGACCCCACAGGATCATGTTGCGCGCCCGAAGCGGTTGGCCAGCACGCCCGTGAAGAAGGCGGGCCAGATATTGATGAAGTCGATGATGAGC
GTGCCCACGCGCGAGTCCGAGATGCCGGCGTCCGAGAAGATGCTGCCGAGTAGTAGAAGACGGCGTTGATGCCCGAGAGCTGCTGCGCGCAGGACAAGAG
AACGCCGCCCAGCAGCTGCAGACGGTAGCGCGGGTTGAACATCGACTCCTTCGCGGGAGCAGCCAGCCCCTCCTCGGCGTTCTCGGGCTTCTTGCTCATC
TGCAGCCACGACAGCGCAGTCTGCACATGCTGTTCGCCGTACAGACGGGCGATGACCTGCTTGGCTTCGTCCGTGCGGCCCTGGGTCAGTAGCCACGCCG
GGCTCTCCACGCACATCGTTGGCGCCAGCAGCAGGTAGGTCACTCCCAGGAGGACTGGGAACGCAGCCAGGTAGCGCCAGCCAGAGCTCGTGTTGGCGAA
GAAGAAGGCGATGGCCGGGAACAAAATGCCGATGGTCGTGAAGATCTGCAGCCCCAGGCCCAGCGTGTTGCGCATGTGCGGCGGCGACAACTCGTTCACG
TAGCTACCGATGGTGGCCGTGGCCGTGCCCGAGGCCAGGCCAGCGATGAGGCGGCCAGCGGAGAAGACCCAGATGTTGGACACCACCGTCTGCACGACGC
CGCCCACGATGATGAAGAGGCAGTTGCCCATGAGCGTCTTCTTGCGGCCGTACTTGTCGCTGAAGTGGCCGCAGCACAGCGACCCGACCATGGCTCCGAA
GATCCACGCGTT