Description :
From Genome Similarity Track
Location :
contig_24:335565- 337209
Transcript NameFunction/comments
g5691.t1XP_009529617.1 hypothetical protein PHYSODRAFT_505836 [Phytophthora sojae
g5692.t1hypothetical protein

Sequence
1644 bases(100 bases per row)
GACGCGGTGAATGAGACCCGTGCGATCGTGAAGATGCTCGTGAAGCTGCTGGGCCCGCAAAACGCGGTTTACTTGTTGAAGTTGGTTTACGAGACGGTGA
ACAGTGAGGAAGCACACGACGCTTTTTTGCTGTGTCGTGACATTCTGCACGAATCGCTGGATGGAGACAACTACCGACATGCAGGAGCGTCGGTGGGGGA
TGCTACGGGCATTACCAGGGCGGTTCATGTTATGAAGGAGGCATACAGCGTGCTTCCCTCTTTTGACGAGCTGCTTGATGCCGCAGCACTTGTTGCTGAT
GTTTCGGACGAGGTGGTTGATGGCGTTGCGCACGTTGTAACTGGGAAGAGGAATTCGAGGGTTCAAATGCGGGGCGAGTCGGATGAAGAAAAGGGGAGCG
CCCCTCGCTTCGAGTACGTGGGTGACGAAGACGAGGAGTCTTTGGCGCATGGTCTAGTGCAGCTCACGGATGAGACGTTTGAACTCGAGGAAAGCAGTAC
ATCTTCGGACGAGGACTTGAACTCCGTCCTCGAGTCGGGCATTTCACTGCTGACGCGAGTGTGCGACAGTGAAGAGGCCTCTTCGCTCTTCAACACCTTT
GGTGACTTTCTGGACGTGCTGGTGGACTAGGCTAAAGAGGTGGCGCTCCAACTGTAAGACACAAATGCTATTTATCCAGCTGCTTGCACTGTAAGGAAAC
TTGAATGGGGGGCCGCTGGGAATATTTGTTTGCTCAGTGAATTGGACTCGTGAAGAACAGCTCCATCTCAACAGCGGGTGCGAGCCAGAGGTGCTTAATC
TGTCTGCTAAAACTTAGTGCTGTTGGCTTAGTACGCCATGTAAGAAAACCTGCTGGTAGTATTTGACTCCGTCATTGAACCATTTTGGCGGCACAACTCA
ACCTGAAGAGCAAATGAGCAGGAGATTCGAGAGCTCACGATGCGGGGGTCAAACGATGACCAGCATCGCCTTATTAACGCATGCGATCAAGCGTTATCCC
AGTTGCCGCGGGAATCTTTGGCTTGTCCATCGGAAACGCTGATGGCTGGCGTTCATGCTCGGTTTGTCGGACACGAAAGTGCTGACAACCACGCGATAAC
GTCTACAGTGGCGAGATTTCGCACGCTAATGAGCACGTGAAACGCTACCAGCCGCAGCGCCGTGAATAGCGACAGATTTCCCGAGCAAGTCGTAGATTTC
ACCTCGATGAGGAAGCGTATCGAGCGATAGCACGTTTCATTGAACAATATCCATCACGGGTCGAGCAACCTATGCGGGTGTGTCGGGACCCTTGGAGACC
AGAGGAGCTGGCACGGGTAGCCGTGCAGTGAAGATGATATTGTCTCAAGTTGCGGTGAAAACCATGAATAAACAACTATTGCGATCCGTTTAAGATTGAA
GCGGGGCTACAGCTGTTGATCCTCGTGAAGTGGAGCTCTGTTGAAGCCTGGTGCGGATACTATGGAGCGCATGGAGTTGATAAAAGACACAGCGCGAGGC
AAACGAGCGGCTGTATGGGAGCATGCTTAGCCAGCAATCGCGTTCGCTTCGCAACTGAAATGAACGACCAAAGGGTGAAGGGCAAACGTGTCGGTGAACA
ACAAGCAAGCATCAAGAACCAGCGGGTTTGAGAACAACGTACGG